Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3367

Hoxb1 homeobox B1 ( MGI:96182)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:3367 EMAGE:3367 EMAGE:3367
Figure 7B of Carpenter et al., 1993 [PMID:7903632] . Copyright: This image is from Carpenter EM, Development 1993 Aug;118(4):1063-75, and is displayed with the permission of The Company of Biologists Limited who owns the Copyright. Figure 7A of Carpenter et al., 1993 [PMID:7903632] . Copyright: This image is from Carpenter EM, Development 1993 Aug;118(4):1063-75, and is displayed with the permission of The Company of Biologists Limited who owns the Copyright. Figure 7C of Carpenter et al., 1993 [PMID:7903632] . Copyright: This image is from Carpenter EM, Development 1993 Aug;118(4):1063-75, and is displayed with the permission of The Company of Biologists Limited who owns the Copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Note: r4 = rhombomere 4. Images A and B are paired views of the same section, whereas C is a higher magnification view of r4 region of different section.
Expression Pattern Description
Spatial Annotation:
EMAGE:3367EMAGE:3367Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mappingspatial mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
3367_voxel_strong_3D_1.wlz
3367_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3367_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
rhombomere 04
moderate moderate
homogeneous
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1346659
Entity Detected:Hoxb1, homeobox B1 ( MGI:96182)
Sequence:sense strand is shown

>MGI:1346659
CCTGCAGGCCCCCCAGGTTGCCCAAAGGAAGCCGCTGGAGATGCCTCTGACCAGTCCGCGTGCACCTCCC
CAGAAGCCTCGCCCAGTTCCATCACCTCTTGAATTGAACTTCCTAAGTAACTGGGCTTCCAACGCTTGAC
CAGTTCTCTCGAAGACTTTCCCAAACTTCACAGCCTTGGTGACCCTCCTCAAGGCCGAGGCACCAGTTTA
GAGCTGCCCAGGAAACTGGGCAGGAGTTGGGAAATGTATTTTTCTCACTCTCAGATCTAGGGGTGGAGGG
ATGAT
nt 863 - nt 1147 of NM_008266.3
Notes:The Hoxb1 probe used in this study by Carpenter et al., 1993 [PMID:7903632] was an "antisense RNA probe complementary to the DNA sequence of the hox-B1 gene encompassing nucleotides 889-1173 (Frohman et al., 1990 [PMID:1983472] ). This sequence is 3' to the homeobox and includes some 3' untranslated region, similar to probe 1 of Frohman et al. (1990 [PMID:1983472] )." See Figure 3 in Frohman et al. for depiction of probe 1. Editor's Note: The nucleotide co-ordinates shown above with reference to the Hoxb1 RefSeq NM_008266.3 were deduced from this information.
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:Hoxa1+/Hoxa1tm1Mrc
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:paraffin
Staining procedure:autoradiography
General Information
Authors:Carpenter EM; Goddard JM; Chisaka O; Manley NR; Capecchi MR, 1993 [PMID:7903632] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:7903632] Carpenter EM, Goddard JM, Chisaka O, Manley NR, Capecchi MR 1993 Loss of Hox-A1 (Hox-1.6) function results in the reorganization of the murine hindbrain. Development (118):1063-75
 [ PMID:1983472] Frohman MA, Boyle M, Martin GR 1990 Isolation of the mouse Hox-2.9 gene; analysis of embryonic expression suggests that positional information along the anterior-posterior axis is specified by mesoderm. Development (110):589-607
Links:MGI:1355501 same experiment
 MGI:1857840 allele description
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI