Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3704

Rhob ras homolog gene family, member B ( MGI:107949)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:3704 EMAGE:3704 EMAGE:3704 EMAGE:3704 EMAGE:3704
Figure 1C. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00333-6] Mech Dev 95: 211-4, Henderson DJ; Ybot-Gonzalez P; Copp AJ, RhoB is expressed in migrating neural crest and endocardial cushions of the developing mouse embryo Copyright 2000. Figure 1B. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00333-6] Mech Dev 95: 211-4, Henderson DJ; Ybot-Gonzalez P; Copp AJ, RhoB is expressed in migrating neural crest and endocardial cushions of the developing mouse embryo Copyright 2000. Figure 1D. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00333-6] Mech Dev 95: 211-4, Henderson DJ; Ybot-Gonzalez P; Copp AJ, RhoB is expressed in migrating neural crest and endocardial cushions of the developing mouse embryo Copyright 2000. Figure 1E. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00333-6] Mech Dev 95: 211-4, Henderson DJ; Ybot-Gonzalez P; Copp AJ, RhoB is expressed in migrating neural crest and endocardial cushions of the developing mouse embryo Copyright 2000. Figure 1F. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00333-6] Mech Dev 95: 211-4, Henderson DJ; Ybot-Gonzalez P; Copp AJ, RhoB is expressed in migrating neural crest and endocardial cushions of the developing mouse embryo Copyright 2000.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Note: b, whole mount view, dotted lines indicate level of sections (c-f). Arrowheads in b) point to first and second branchial arches, arrows point to the segmental pattern in the paraxial mesoderm of the trunk. Large arrow points to midbrain/hindbrain boundary. c) section through brain, arrowheads point to maxillary processes, arrow to area adjacent to neural tissue. Large arrow points to otocyst. d) Arrowheads point to branchial arches. Arrows to branchial arch arteries, large arrow to presumptive melanocyte precursors underneath the surface ectoderm. Large arrowhead is ectoderm first arch. e) Arrowheads point to branchial arch mesenchyme, arrow to branchial arch arteries. f) arrow points to dorsal root ganglia, arrowheads to the developing sympathetic chain adjacent to the aorta, large arrowhead = floor plate of neural tube. a, atrium; as, aortic sac; fg, foregut; nt, neural tube; v, ventricles; 1-3, branchial arches 1,2 and 3; V, trigeminal ganglion; IX, glosso-pharyngeal ganglion. Scale bar in (b) 700 microns; (c-f) 175 microns.
Expression Pattern Description
Spatial Annotation:
EMAGE:3704EMAGE:3704EMAGE:3704EMAGE:3704EMAGE:3704Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D mapping3D mapping3D mappingspatial mapping
EMAGE:3704
wholemount mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
3704_wholemount_strong_3D_5.wlz
3704_wholemount_moderate_3D_5.wlz
3704_wholemount_possible_3D_1.wlz
3704_wholemount_notDetected_3D_5.wlz
3704_voxel_moderate_3D_1.wlz
3704_voxel_weak_3D_1.wlz
3704_voxel_notDetected_3D_1.wlz
3704_voxel_strong_3D_1.wlz
3704_voxel_moderate_3D_2.wlz
3704_voxel_weak_3D_2.wlz
3704_voxel_notDetected_3D_2.wlz
3704_voxel_strong_3D_2.wlz
3704_voxel_moderate_3D_3.wlz
3704_voxel_weak_3D_3.wlz
3704_voxel_notDetected_3D_3.wlz
3704_voxel_strong_3D_3.wlz
3704_voxel_moderate_3D_4.wlz
3704_voxel_weak_3D_4.wlz
3704_voxel_notDetected_3D_4.wlz
3704_voxel_strong_3D_4.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3704_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
1st branchial arch
detected detected
regionalExpression in streams of cells migrating into the branchial arches. Expression in ectoderm.
2nd branchial arch
detected detected
regionalExpression in streams of cells migrating into the branchial arches.
trunk paraxial mesenchyme
detected detected
regionalExpression in a segmental pattern.
future midbrain
detected detected
regionalExpression at the midbrain/hindbrain boundary.
future hindbrain
detected detected
regionalExpression at the midbrain/hindbrain boundary.
1st branchial arch maxillary component
detected detected
glossopharyngeal ix preganglion
detected detected
trigeminal v preganglion
detected detected
otocyst
detected detected
regionalExpression in dorso-lateral portion.
future brain
detected detected
regionalExpression surrounding the neural tube.
2nd branchial arch mesenchyme
detected detected
regionalExpression surrounding the branchial rach arteries.
3rd branchial arch mesenchyme
detected detected
regionalExpression surrounding the branchial rach arteries.
surface ectoderm
detected detected
regionalExpression in melanocyte precursors.
branchial arch
detected detected
regionalExpression in branchial arch mesenchyme, and surrounding the arch arteries.
outflow tract
detected detected
dorsal root ganglion
detected detected
peripheral nervous system
detected detected
regionalExpression in the developing sympathetic chain adjacent to the aorta.
foregut
detected detected
spotted
neural tube floor plate
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1862033
Entity Detected:Rhob, ras homolog gene family, member B ( MGI:107949)
Sequence:sense strand is shown

>MGI:1862033
CGTGTTCGAGAACTATGTGGCGGACATCGAGGTGGACGGCAAGCAGGTGGAGCTGGCGCTGTGGGACACG
GCAGGCCAGGAGGACTACGATCGTTTACGGCCGCTCTCCTATCCGGACACCGACGTCATCCTTATGTGCT
TCTCGGTGGACAGCCCGGACTCTCTCGAGAACATCCCCGAGAAGTGGGTGCCCGAGGTAAAGCACTTCTG
CCCCAATGTGCCCATCATCCTGGTGGCCAACAAAAAAGACCTGCGCAGCGACGAGCATGTCCGCACGGAG
CTGGCCCGCATGAAGCAGGAGCCAGTGCGCACGGATGACGGCCGCGCCATGGCGGTGCGCATCCAAGCCT
ATGACTACCTCGAGTGCTCGGCCAAGACCAAGGAGGGCGTGCGCGAGGTTTTTGAGACGGCCACGCGCGC
CGCGCTGCAGAAGCGCTACGGATCCCAGAATGGCTGCATCAACT
nt 4063 - nt 4526 of X99963.1
Notes:The Rhob probe used in this study by Henderson et al., 2000 [PMID:10906464] "was obtained from GenBank [sequence] (accession number x99963) and a 463 bp fragment was amplified by RT-PCR. This corresponds to the region between positions 4063 and 4526 of the cDNA sequence".
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:CD-1
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:sectioned wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Henderson DJ; Ybot-Gonzalez P; Copp AJ, 2000 [PMID:10906464] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(00)00333-6] [ PMID:10906464] Henderson DJ, Ybot-Gonzalez P, Copp AJ 2000 RhoB is expressed in migrating neural crest and endocardial cushions of the developing mouse embryo. Mech Dev (95):211-4
Links:MGI:2384277 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI