Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3859

Alx3 aristaless-like homeobox 3 ( MGI:1277097)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:3859 EMAGE:3859 EMAGE:3859
Fig1B.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00450-6] Mech Dev 107: 163-7, Beverdam A; Meijlink F, Expression patterns of group-I aristaless-related genes during craniofacial and limb development. Copyright 2001 Fig1.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00450-6] Mech Dev 107: 163-7, Beverdam A; Meijlink F, Expression patterns of group-I aristaless-related genes during craniofacial and limb development. Copyright 2001 Fig1C. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00450-6] Mech Dev 107: 163-7, Beverdam A; Meijlink F, Expression patterns of group-I aristaless-related genes during craniofacial and limb development. Copyright 2001

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
B is a lateral view and C a frontal view of the same embryo. Abbreviations in the cartoon: LNP, lateral nasal process; Mn, mandibular arch; Mx, maxillary process; O, otocyst; 2nd, 2nd branchial arch.
Expression Pattern Description
Spatial Annotation:
EMAGE:3859Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3859_wholemount_strong_3D_1.wlz
3859_wholemount_moderate_3D_1.wlz
3859_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3859_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
1st branchial arch mandibular component
detected detected
regionalExpression is in the distal mandibular arch.
latero-nasal process
detected detected
medial-nasal process
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1277367
Entity Detected:Alx3, aristaless-like homeobox 3 ( MGI:1277097)
Sequence:sense strand is shown

>MGI:1277367
CCATGGAAATGTGGCTGGCTTCATGGGAGTGCCAGCCTCCCCTGCAGCCCACCCTGGCATCTATTCCATC
CATGGCTTCCCTCCTGCCCTGGGAGGGCACAGCTTTGAGCCTTCTCCGGATGGTGACTACAAGTCCCCAA
GCCTCGTTTCACTCAGGATGAAGCCCAAAGAGCCCCCTGGCCTGCTGAACTGGACCACGTGATGGGTTAC
ATGGGCACAGACTGAGCTGTCCACTTCTCTTCCTGCTCTGACCTGCTCCTAGCCCATCTCTACCTGGACA
CCAAACAGCAAACCCTTTTACCTCCATAACCTGGGTGGTTCTGGAAGCTTGGAAGAGGAGCTGGGACCCT
CAGCCTCCTGCAGGGAACAGGCTACAGGGTCTTATTTCTTAAAATAGGTGGGGCTGCCTAGGAGACAGGG
ACTTCAAAGCAGGTAGGACTCCTCCTTATAAAATGGCTCCCCTCATTTAAATTGGGCTGGAGAAAAGGTG
ACAGATGCCCCCTGTTTTCCAAAGACTGTTTCTAAGTCCAGGGAGCCCAGGAAGATGGGAGGAGGGTGCA
GACTAAACAGGGAGGCGCTCTCTGTGGTTCTTAGGGCTGGCCTCACTTTTGCCTTCCTACCACCAGGGGG
CGGTACGCTCAGCTCCTGGGACTGACAAGATCCCAGACGGTGAAGGTCAGCTCAATAATAGGTGGGGGGG
TCTCCTCTGTTCCAAGCATCCCTCACTTCTGCCCTGTGCTAGTCTACAGAGATACTATAAAGTCATTTTC
TCCAAGTAGGGAGAAGAAATTCCACCAAACATTAAATATTTGGATTTGCTTTCATGGGATCAGGGATATG
CCATGAAAACCATATTGGACATCGATCAAAATAAAAAAAAAATTTTTTTTCC
nt 979 - nt 1870 of U96109.1
Notes:The Alx3 probe used in this study by Beverdam and Meijlink (2001) [PMID:11520673] is indicated as that used by ten Berge et al (1998) [PMID:9676189] i.e. "A plasmid consisting of a 1.856-kb Alx3 cDNA cloned in pEXLox (Novagen) was cut with NcoI and transcribed with Sp6 polymerase. This results in an antisense RNA complementary to the 3'-untranslated region of the mRNA and the part encoding the C-terminal 66 amino acids." Editors note: Alx3 sequence U96109.1 was submitted to GenBank by ten Berge. Restriction cutting of U96109.1 with NcoI identifies 3 sites. A cut at the most 3' site (position 1048) would yield a fragment containing the 3'UTR and the most C-terminal 44 amino acids, whereas a cut at the second most 3' site (position 979) would yield a fragment containing the 3'UTR and the most C-terminal 66 amino acids as ten Berge states in their description. As such the sequence from 979 - the 3' end of the clone has been included here as the probe sequence.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Beverdam A; Meijlink F (2001) [PMID:11520673] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(01)00450-6] [ PMID:11520673] Beverdam A, Meijlink F 2001 Expression patterns of group-I aristaless-related genes during craniofacial and limb development. Mech Dev (107):163-7
 [ doi:10.1006/dbio.1998.8921] [ PMID:9676189] ten Berge D, Brouwer A, el Bahi S, GuĂ©net JL, Robert B, Meijlink F 1998 Mouse Alx3: an aristaless-like homeobox gene expressed during embryogenesis in ectomesenchyme and lateral plate mesoderm. Dev Biol (199):11-25
Links:MGI:3039023 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI