Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3912

En2 engrailed 2 ( MGI:95390)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:3912
Fig 4K. Copyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.2001.0531] Dev Biol 242: 204-23, Tian E; Kimura C; Takeda N; Aizawa S; Matsuo I, Otx2 is required to respond to signals from anterior neural ridge for forebrain specification. Copyright 2002

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: Arrows indicate expression in mesencephalon and anterior metencephalon.
Expression Pattern Description
Spatial Annotation:
EMAGE:3912Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3912_wholemount_strong_3D_1.wlz
3912_wholemount_moderate_3D_1.wlz
3912_wholemount_possible_3D_1.wlz
3912_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3912_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
future midbrain
detected detected
future hindbrain
detected detected
regionalExpression in anterior metencephalon.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1331401
Entity Detected:En2, engrailed 2 ( MGI:95390)
Sequence:sense strand is shown

>MGI:1331401
AGATCTTTCTTTCATTTTTCTTTTCTCCCTTTTTTTAATCCCTTAAACTCCTTATGGGACATTGGACACT
TCTTCCCCCGAAAGAAAAAAAATTTAAAACAACTTGCTGAAGTCCAAAGATTTTTATTGCTGCATTTCAC
AGGACTGTGAACCGAATAAATAGCTCCTATTTGGTCTGTGGGCTCTGCCGCTTGCTTTGTGCTGGCTCGG
ACAGGTACTGTAGGAAGCGCCAGCCAGCGTGGTGATGGGAGAGCT
nt 1315 - nt 1569 of NM_010134.1
Notes:The En2 probe used in this study by Tian et al., 2002 [PMID:11820816] is indicated as that previously described by Davis and Joyner, 1988 [PMID:2907320] and Davis et al., 1988 [PMID:2454212] i.e. "the 3' noncoding BglI-SstI fragment" 260bp in length.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:involves: C57BL/6 * CBA
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Tian E; Kimura C; Takeda N; Aizawa S; Matsuo I, 2002 [PMID:11820816] , Indexed by GXD, Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1006/dbio.2001.0531] [ PMID:11820816] Tian E, Kimura C, Takeda N, Aizawa S, Matsuo I 200 Otx2 is required to respond to signals from anterior neural ridge for forebrain specification. Dev Biol (242):204-23
 [ doi:10.1101/gad.2.12b.1736] [ PMID:2907320] Davis CA, Joyner AL 1988 Expression patterns of the homeo box-containing genes En-1 and En-2 and the proto-oncogene int-1 diverge during mouse development. Genes Dev (2):1736-44
 [ doi:10.1101/gad.2.3.361] [ PMID:2454212] Davis CA, Noble-Topham SE, Rossant J, Joyner AL 1988 Expression of the homeo box-containing gene En-2 delineates a specific region of the developing mouse brain. Genes Dev (2):361-71
Links:MGI:2179007 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI