EMAGE mouse gene expression spatial database

EMAGE:3927

Gli1 GLI-Kruppel family member GLI1 ( MGI:95727)
TS17 (10.5 dpc)
in situ hybridisation

Data Images


Fig3ECopyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.1999.9311] Dev Biol 211: 323-34, Goodrich LV; Jung D; Higgins KM; Scott MP, Overexpression of ptc1 inhibits induction of Shh target genes and prevents normal patterning in the neural tube. Copyright 1999

Expression pattern clarity:
Find spatially similar expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

3D mapping

View mapped 3D expression image

Download individual expression domains:

Download all expression domains:

Find spatially similar expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

neural tube

detected

graded

A ventral to dorsal gradient of expression was seen.

neural tube floor plate

not detected

homogeneous

trunk somite

strong

Authors describe expression in the sclerotome.

Annotation Validation:

EMAGE Editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	MGI:1277646
Entity Detected:	Gli1, GLI-Kruppel family member GLI1 ( MGI:95727)
Sequence:	sense strand is shown >MGI:1277646 CAGGGAAGAGAGCAGACTGACTGTTCCCGAGAGTGCCATGCCGCAGCAGAGCCCCGGAGCGCAGTCCTCT TGCAGCAGCGACCACTCCCCAGCAGGCAGTGCGGCCAACACGGACAGCGGCGTGGAGATGGCCGGCAACG CGGGCAGCACTGAGGACTTGTCCAGCTTGGATGAAGGACCTTGTGTCTCGGCCACCGGACTCTCCACGCT TCGCCGCCTGGAGAACCTTAGGCTGGATCAGCTGCAT
	nt 1439 - nt 1685 of AF026305.1
Notes:	The Gli1 probe used in this study by Goodrich et al., 1999 [PMID:10395791] is indicated as that previously described by Hui et al., 1994 [PMID:8150204] , who in turn refer to Walterhouse et al., 1993 [PMID:8364225] who describes its production as such: "Primers outside the mouse gli cDNA zinc finger region were used to amplify a 262 base pair non-zinc finger domain. Non-zinc finger gli primers included: (sense) 5'-CTGATTTCAGGGAAGAGAGCAGACTGA-3' and (anti-sense) 5'-ACAAGCTTATGCAGCTGATCCAGCCTA-3'."
Chemistry:	RNA
Strand:	antisense
Label:	S35

Specimen

Procedures

Staining procedure:

autoradiography

General Information

Authors:	Goodrich LV; Jung D; Higgins KM; Scott MP, 1999 [PMID:10395791] , Indexed by GXD, Spatially Mapped by EMAGE.
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	non-screen
References:	[ doi:10.1006/dbio.1999.9311] [ PMID:10395791] Goodrich LV, Jung D, Higgins KM, Scott MP 1999 Overexpression of ptc1 inhibits induction of Shh target genes and prevents normal patterning in the neural tube. Dev Biol (211):323-
	[ doi:10.1006/dbio.1994.1097] [ PMID:8150204] Hui CC, Slusarski D, Platt KA, Holmgren R, Joyner AL 1994 Expression of three mouse homologs of the Drosophila segment polarity gene cubitus interruptus, Gli, Dev Biol (162):402-13
	[ doi:10.1002/aja.1001960203] [ PMID:8364225] Walterhouse D, Ahmed M, Slusarski D, Kalamaras J, Boucher D, Holmgren R, Iannaccone P 1993 gli, a zinc finger transcription factor and oncogene, is expressed during normal mouse development. Dev Dyn (196):91-102
	[ doi:10.1126/science.276.5313.817] [ PMID:9115210] Oro AE, Higgins KM, Hu Z, Bonifas JM, Epstein EH, Scott MP 1997 Basal cell carcinomas in mice overexpressing sonic hedgehog. Science (276):817-21
Links:	MGI:1342040 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source