Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3934

Hoxb8 homeobox B8 ( MGI:96189)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:3934
Fig4ACopyright: Reprinted with permission from Elsevier from [doi:10.1016/j.ydbio.2003.07.020] Dev Biol 264: 77-90, Medina-Martinez O; Ramirez-Solis R, In vivo mutagenesis of the Hoxb8 hexapeptide domain leads to dominant homeotic transformations that mimic the loss-of-function mutations in genes of the Hoxb cluster. Copyright 2003

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:3934Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3934_wholemount_strong_3D_1.wlz
3934_wholemount_moderate_3D_1.wlz
3934_wholemount_weak_3D_1.wlz
3934_wholemount_possible_3D_1.wlz
3934_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3934_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
somite 12
detected detected
somite 13
detected detected
somite 14
detected detected
somite 15
detected detected
somite 16
detected detected
somite 17
detected detected
somite 18
detected detected
somite 19
detected detected
somite 20
detected detected
somite 22
detected detected
somite 21
detected detected
somite 23
detected detected
somite 24
detected detected
somite 25
detected detected
somite 26
detected detected
somite 27
detected detected
somite 28
detected detected
somite 29
detected detected
somite 30
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3027727
Entity Detected:Hoxb8, homeobox B8 ( MGI:96189)
Sequence:sense strand is shown

>MGI:3027727
AACTCACTGTTCTCCAAATACAAAACCGGGGAGTCCCTGCGCCCCAATTATTATGACTGCGGCTTCGCCC
AGGACCTGGGCGGCCGACCCACCGTGGTGTACGGTCCCAGCAGCGGCGGCAGCTTCCAGCACCCTTCGCA
AATCCAGGAGTTCTACCACGGGCCATCGTCGCTGTCCACAGCTCCCTACCAGCAGAACCCGTGCGCCGTG
GCGTGCCACGGCGACCCCGGCAACTTCTACGGCTACGACCCTCTGCAGCGCCAGAGCCTGTTCGGTGCGC
AG
nt 1077 - nt 1358 of NM_010461.2
Notes:The Hoxb8 probe used in this study by Medina-Martinez & Ramirez-Solis, 2003 [PMID:14623233] is described as "a HincII-BamHI coding fragment containing sequence in the first exon. Editors Note: the start/end co-ordinates of the probe sequence w.r.t. the Hoxb8 cDNA RefSeq NM_010461.2 were deduced using this information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Staining procedure:alkaline phosphatase + unspecified
General Information
Authors:Medina-Martinez O; Ramirez-Solis R, 2003 [PMID:14623233] , Indexed by GXD, Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/j.ydbio.2003.07.020] [ PMID:14623233] Medina-Martinez O, Ramirez-Solis R 2003 In vivo mutagenesis of the Hoxb8 hexapeptide domain leads to dominant homeotic transformations that mimic the loss-of-function mutations in genes of the Hoxb cluster. Dev Biol (264):77-90
Links:MGI:3028605 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI