| Type: | in situ hybridisation probe |
| Identifier: | MGI:3694250 |
| Entity Detected: | Lrrtm2, leucine rich repeat transmembrane neuronal 2 ( MGI:2389174) |
| Sequence: | sense strand is shown
>MGI:3694250
GTCAGCAGCTGCCATACAAAGAATGTGAAGTATAATATCTACCCATCATCAAAAATCACATCAGATAAGT
AACCTATTTTACATAGTAGGGGCTAAATACATATCTAATTTTTACCAATGGTGACATTAAGCCTAATTTT
CCAAACCAAGTGGAGACTTGAGTTTTTGAAGTGTTAAAGTATTTTTAATTTTTTAATGAAAACATATTTT
AAGTGTTAAGTGAAGCAATGCTCACATTAATTTGCACTCTTGTTGGAAAGTCTAAATGCTTACTTCAATA
TAAAACATTTCATGTATGTAATTATATACAACTGTATGTAAACATTTGCGCTAAGGTCTCCATATGTTTT
TTGGTTTTTTTTTTTACTGAAAACAGTTCCAAAAGATGCTACTAAACAAATATAGGTAGGGACAAAAACC
TGTTTGATTATTATTCTCCATCCTATGGACCACAACTGGCTTCCTACTTAAGAAGGAGACAGCAAAGTTC
TCTTGTAAGATAATGTGGTATTTACTCAAATTATAATTTACTGCCAGTATAAGAAGTAGACTTACATGTG
TGCTTAAGACTGGTAAATATTAAACGTTATTCTTTCAGTTTGGCTTGGCT
|
| | nt 81037 - nt 81646 of AC121874.2 |
| Notes: | The Lrrtm2 probe used in this study by Haines & Rigby, 2007 [PMID:16860615] is a mixture of two probes, the preparation of which is described as follows: "Two LRRTM2 probes were obtained by PCR using primers 5'-GTCAGCAGCTGCCATACAAA and 5'-AGCCAAGCCAAACTGAAAGA (LRRTM2 RT1), and 5'-AAGCTGCAGACCTTGCATTT and 5'-TGGCAGTGACAGTGGTTGAT (LRRTM2 RT2) from the BAC RP24-124K16 which contains the LRRTM2 gene. The PCR products were cloned into EcoRV digested pBluescript II KS yielding the plasmids LRRTM2 RT1 and LRRTM2 RT2. Antisense riboprobes were generated by digesting LRRTM2 RT1 with EcoRI and transcribing with T3 RNA polymerase and digesting LRRTM2 RT2 with SalI and transcribing with T7 RNA polymerase. Both probes were used in a single in situ hybridisation."
Editors Note: the nucleotide sequences of each probe fragment, relative to the BAC RP24-124K16 sequence (AC121874.2) are - LRRTM2 RT1: nt 81037-81646 and LRRTM2 RT2: nt 79995-80631. EcoRI and SalI cut externally to these fragments. |
| Chemistry: | RNA |
| Strand: | antisense |
| Label: | digoxigenin |