Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5873

Zfp747 zinc finger protein 747 ( MGI:2443581)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:5873
1633d1.jpg. This embryo was treated with ProteinaseK for either 3min or 30min.

Expression pattern clarity: one star
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:5873Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5873_wholemount__possible.wlz
5873_wholemount__notDetected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5873_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
central nervous system
possible possible
Authors stated that in some instances they could not determine expression levels with certainty.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3507023
Entity Detected:Zfp747, zinc finger protein 747 ( MGI:2443581)
Notes:The Zfp747 probe used in this study by Gray et al., 2004 [PMID:15618518] was generated by PCR with primers GTCTACATGGCGCAGGTGATGG and GTGAGTGTACATGTGTGCCTCC.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Gray PA; Fu H; Luo P; Zhao Q; Yu J; Ferrari A; Tenzen T; Yuk DI; Tsung EF; Cai Z; Alberta JA; Cheng LP; Liu Y; Stenman JM; Valerius MT; Billings N; Kim HA; Greenberg ME; McMahon AP; Rowitch DH; Stiles CD; Ma Q [PMID:15618518] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1126/science.1104935] [ PMID:15618518] Gray PA, 2004 Mouse brain organization revealed through direct genome-scale TF expression analysis. Science (306):2255-7
Links:MGI:3509770 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE