Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:59

Otx2 orthodenticle homolog 2 (Drosophila) ( MGI:97451)
TS15 (9.7 dpc)
in situ hybridisation

Data Images
EMAGE:59
Figure 4A of Martinez-Barbera et al., 2001 [PMID:11731459] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:59Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
59_wholemount_strong_3D_1.wlz
59_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:59_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
future midbrain
detected detected
regionalExpression is on the mesencephalic side of the midbrain-hindbrain junction.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1309443
Entity Detected:Otx2, orthodenticle homolog 2 (Drosophila) ( MGI:97451)
Sequence:sense strand is shown

>MGI:1309443
AAATCTACCCACCAAGGACCCTGACCCTGTCCACTCCAGGCGAATCGAGACCGTCCGGCTGGGTCCCCCC
AATTTGGGCCGACTTTGCGCCTCCAAACAACCTTAGCATGATGTCTTATCTAAAGCAACCGCCTTACGCA
GTCAATGGGCTGAGTCTGACCACTTCGGGTATGGACTTGCTGCATCCCTCCGTGGGCTACCCCGCCACCC
CCCGGAAACAGCGAAGGGAGAGGACGACATTTACTAGGGCACAGCTCGACGTTCTGGAAGCTCTGTTTGC
CAAGACCCGGTACCCAGACA
nt 226 - nt 525 of NM_144841.1
Notes:Probe used in this study by Martinez-Barbera et al., 2001 [PMID:11731459] is indicated as being originally described by Acampora et al., 1998 [PMID:9811592] ie. "Probe B" in Figure 1A of the latter, which "includes 107 bp and 190 bp upstream and downstream the AUG respectively" ie. nt 226-525 in NM_144841.1.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Strain:C57BL/6 x DBA/2
Age:9.7 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Staining procedure:undefined
General Information
Authors:Martinez-Barbera et al., 2001 [PMID:11731459] Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:11731459] Martinez-Barbera JP, Signore M, Boyl PP, Puelles E, Acampora D, Gogoi R, Schubert F, Lumsden A, Simeone A 2001 Regionalisation of anterior neuroectoderm and its competence in responding to forebrain and midbrain inducing activities depend on mutual antagonism between OTX2 and GBX2. Development (128):4789-800
 [ PMID:9811592] Acampora D, Avantaggiato V, Tuorto F, Briata P, Corte G, Simeone A 1998 Visceral endoderm-restricted translation of Otx1 mediates recovery of Otx2 requirements for specification of anterior neural plate and normal gastrulation. Development (125):5091-104
Links:MGI:2155488 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI