| Type: | in situ hybridisation probe |
| Identifier: | MGI:3778180 |
| Entity Detected: | Dusp7, dual specificity phosphatase 7 ( MGI:2387100) |
| Sequence: | sense strand is shown
>MGI:3778180
GGCTCCATAATACTCCTCCGGTTTCATCGCTTCTCAGCCTTGCTTCTCCCTGGGCACCATGAGGAACAGG
AAGTGCTGGGGTCCTGATGGGACGCACACCCGCAGGGGGCAGTGACTGAGGCCACGTCTTACCTCACAGG
GCTGGTTTTCAGGGATTCTTTAGGGAAGCAGTTTAAAATCTTGCCACAGTTGAGAAATTGGCAAAAAAAA
CCCAAAAAAAAAAAAAAA
|
| | nt 2357 - nt 2855 of NM_153459.1 |
| Notes: | The Dusp7 probe used in this study by Urness et al., 2008 [PMID:18058922] is described as being "generated from a clone containing a 498-bp segment of the 3'UTR (2,357-2,855 bp of GenBank accession no. NM_153479)".
Editor's note: NM_153479 is a typographical error by the author - it encodes human CSAG1. NM_153459 is the Mus musculus Dusp7 mRNA RefSeq. |
| Chemistry: | RNA |
| Strand: | antisense |
| Label: | digoxigenin |