Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6096

Atpif1 ATPase inhibitory factor 1 ( MGI:1196457)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6096 EMAGE:6096 EMAGE:6096 EMAGE:6096 EMAGE:6096
"Pseudo-wholemount" of euxassay_010603. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010603_01 euxassay_010603_02 euxassay_010603_03 euxassay_010603_04
EMAGE:6096 EMAGE:6096 EMAGE:6096 EMAGE:6096 EMAGE:6096
euxassay_010603_05 euxassay_010603_06 euxassay_010603_07 euxassay_010603_08 euxassay_010603_09
EMAGE:6096 EMAGE:6096 EMAGE:6096 EMAGE:6096 EMAGE:6096
euxassay_010603_10 euxassay_010603_11 euxassay_010603_12 euxassay_010603_13 euxassay_010603_14
EMAGE:6096 EMAGE:6096 EMAGE:6096 EMAGE:6096 EMAGE:6096
euxassay_010603_15 euxassay_010603_16 euxassay_010603_17 euxassay_010603_18 euxassay_010603_19
EMAGE:6096 EMAGE:6096 EMAGE:6096
euxassay_010603_20 euxassay_010603_21 euxassay_010603_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6096Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6096_wholemount_strong.wlz
6096_wholemount_moderate.wlz
6096_wholemount_weak.wlz
6096_wholemount_possible.wlz
6096_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6096_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 09 10 11 12
submandibular gland primordium
weak weak
regionalweak expression: see section 06 07 08 13 14 15
thyroid gland
weak weak
regionalweak expression: see section 09 12
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 09 14 15
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 16 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 14 15
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 15
ventral grey horn
moderate moderate
regionalmoderate expression: see section 12 14 15 weak expression: see section 09 10 11 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 09 10 13 14 15 16 17 18 weak expression: see section 08 11 12
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 04 21 22
mandible
moderate moderate
regionalmoderate expression: see section 19 20 21 weak expression: see section 03 04 05 06 07 08 09 10 12 13 14 15 16 17 18
maxilla
weak weak
regionalweak expression: see section 06 07 08 09 10 15 16
liver lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
orbito-sphenoid
weak weak
regionalweak expression: see section 05 06 07 08 19 20 21 22
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30852
Entity Detected:Atpif1, ATPase inhibitory factor 1 ( MGI:1196457)
Sequence:sense strand is shown

>T30852
CGCGCTAGGAGAGAAGCAGCCACGCCCGCAACGCGAGCTGAGCAACGCCGAAGACAATGGCAGGCTCGGC
GTTGGCAGTTCGGGCTCGGTTCGGTGTCTGGGGTATGAAGGTCCTGCAAACCCGAGGCTTCGTCTCGGAC
TCGTCGGATAGCATGGATACGGGCGCTGGCTCCATCCGAGAAGCTGGTGGAGCCTTCGGAAAACGAGAAA
AGGCTGAAGAGGATCGGTACTTCCGAGAGAAGACTAAAGAACAGCTGGCTGCCCTGAGGAAACACCATGA
AGATGAGATTGACCACCATTCGAAGGAGATAGAGCGTCTGCAGAAGCAAATTGAACGCCATAAGAAGAAG
ATCCAACAACTAAAGAATAATCATTGAATGCGCGCAGTCGGTCCCTCACAGAGTGGCCCGTATCACTCCC
CACGTCTGTAGACAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4217188), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 17015. Forward Primer - name:017015_F_IRAV24-27_A01_Atpi, sequence:CGCGCTAGGAGAGAAGCA; Reverse Primer - name:017015_R_SP6_IRAV24-27_A01_Atpi, sequence:TGTGTCTACAGACGTGGGGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15449 same embryo
 EMAGE:15446 same embryo
 EMAGE:15448 same embryo
 EMAGE:15447 same embryo
 EMAGE:15450 same embryo
 EurExpress:euxassay_010603 same experiment
 MGI:4823347 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS