Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6355

Col27a1 collagen, type XXVII, alpha 1 ( MGI:2672118)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6355 EMAGE:6355 EMAGE:6355 EMAGE:6355 EMAGE:6355
"Pseudo-wholemount" of euxassay_016233. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016233_01 euxassay_016233_02 euxassay_016233_03 euxassay_016233_04
EMAGE:6355 EMAGE:6355 EMAGE:6355 EMAGE:6355 EMAGE:6355
euxassay_016233_05 euxassay_016233_06 euxassay_016233_07 euxassay_016233_08 euxassay_016233_09
EMAGE:6355 EMAGE:6355 EMAGE:6355 EMAGE:6355 EMAGE:6355
euxassay_016233_10 euxassay_016233_11 euxassay_016233_12 euxassay_016233_13 euxassay_016233_14
EMAGE:6355 EMAGE:6355 EMAGE:6355 EMAGE:6355 EMAGE:6355
euxassay_016233_15 euxassay_016233_16 euxassay_016233_17 euxassay_016233_18 euxassay_016233_19
EMAGE:6355 EMAGE:6355 EMAGE:6355 EMAGE:6355 EMAGE:6355
euxassay_016233_20 euxassay_016233_21 euxassay_016233_22 euxassay_016233_23 euxassay_016233_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6355Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6355_wholemount_strong.wlz
6355_wholemount_moderate.wlz
6355_wholemount_weak.wlz
6355_wholemount_possible.wlz
6355_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6355_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 13 14 15 16 17 18 19 21 22 23 24
forelimb digit 1 phalanx
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03 04
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03 04 19 20 21
forelimb digit 3 phalanx
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03 04 19 20 21
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 22 23 24
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 03 19
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 02 moderate expression: see section 20
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 02 03 19 moderate expression: see section 18 20 weak expression: see section 04
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 02 moderate expression: see section 20
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 02 03 19 moderate expression: see section 18 20 weak expression: see section 04
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 02 moderate expression: see section 20
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 02 03 19 moderate expression: see section 18 20 weak expression: see section 04
hindlimb digit 5 metatarsal
moderate moderate
regionalmoderate expression: see section 20
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 03 19 moderate expression: see section 18 20 weak expression: see section 04
foot mesenchyme
strong strong
regionalstrong expression: see section 02 03 21
fibula
strong strong
regionalstrong expression: see section 01 moderate expression: see section 22 23
tibia
strong strong
regionalstrong expression: see section 01 moderate expression: see section 22 23
femur
strong strong
regionalstrong expression: see section 01 23 24
vibrissa
moderate moderate
regionalmoderate expression: see section 04 05 06 17 18 19
otic capsule
strong strong
regionalstrong expression: see section 08 09 10 16 17
nasal septum
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
hyoid
moderate moderate
regionalmoderate expression: see section 10 15 16
meckel's cartilage
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 11 12
cricoid cartilage
strong strong
regionalstrong expression: see section 14 15 moderate expression: see section 10 weak expression: see section 12
thyroid cartilage
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 11 weak expression: see section 12
lung
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 13 14 15 16 17 18 19 20 21 moderate expression: see section 10 11 12
trachea
strong strong
regionalstrong expression: see section 13
axial skeleton
strong strong
regionalstrong expression: see section 10 12 13 14 15 16
exoccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 19 20 21 22 23 24
temporal bone
strong strong
regionalstrong expression: see section 02 03 04 05 06 19 20 21 22 23
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 11 12 13 14 17 18 19 20 21 22 23 24
viscerocranium
strong strong
regionalExpression in the turbinate bone.
clavicle
strong strong
regionalstrong expression: see section 08 09 15 16 weak expression: see section 07
sternum
strong strong
regionalstrong expression: see section 11 12
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 09 10 17 18 19
axial skeleton tail region
strong strong
regionalstrong expression: see section 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45429
Entity Detected:Col27a1, collagen, type XXVII, alpha 1 ( MGI:2672118)
Sequence:sense strand is shown

>T45429
TTGAAGGTGCACTCTGTCAGTTCAGCATCCACCCTGTGGCGCAGGTCGCTCACAATTACTGTGCCCACCT
GAGAGAGCGGTGCCGACAGGTGGACACATATAGTCCCCAGGTGGGAACCCTCTTTCCTTGGGACTCTGGC
CCAGCCTTTGCTTTGCATCCTGAACCAGCCTTGCTTGGCTTGGGGAATCTGACCAGAACTCCAGCAACCC
TGGGGGCCAGGCCTGTAAGCAGGGCACTTGCAGTGACTGTGGCTCGTGCCATGCCCACCAAGCCCGTGAG
GTCTGTCCGCCCAGATGTCTCTGAACGCAGCTGTTCCCAGACCCCACTGTCACCTGCCAAACAGTCGGCC
AGGAAAACACCTTCCCCCTCGTCGTCAGCTTCCCTGGCTAATTCCACCAGGGTTTATCGTCCAGCTGCTG
CCCAGCCAAGACAGATCACAACTACTAGCCCCACCAAACGTTCCCCCACCAAGCCTTCTGTTTCTCCCCT
TTCAGTTACCCCCATGAAAAGTCCCCATGCAACCCAGAAAACAGGTGTCCCTTCATTCACAAAGCCTGTT
CCACCCACTCAGAAGCCAGCGCCCTTCACCTCCTACCTAGCACCTTCCAAAGCCTCTAGTCCCACTGTGA
GGCCTGTTCAGAAGACTTTCATGACACCCCGACCTCCAGTCCCCAGCCCCCAGCCCCTGCGCCCTACTAC
TGGCTTATCTAAGAAGTTCACTAACCCCACTGTTGCAAAATCTAAGTCCAAGACGACCAGTTGGGCCAGC
AAGCCGGTCTTGGCCCGCTCCAGTGTCCCTAAAACGCTTCAGCAAACTGTTTTGTCCCAGTCTCCTGTTT
CCTATCTGGGCTCTCAGACACTGGCTCCAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 194184. Forward Primer - name:194184_F_exon_Col27a1, sequence:TTGAAGGTGCACTCTGTCAGTT; Reverse Primer - name:194184_N_SP6_exon_Col27a1, sequence:GCTGGAGCCAGTGTCTGAGAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6357 same embryo
 EMAGE:6354 same embryo
 EMAGE:6356 same embryo
 EMAGE:6353 same embryo
 EMAGE:6358 same embryo
 EurExpress:euxassay_016233 same experiment
 MGI:4823988 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS