EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6502

Mir680-3 microRNA 680-3 ( MGI:3629889)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_019063. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_019063_01	euxassay_019063_02	euxassay_019063_03	euxassay_019063_04

euxassay_019063_05	euxassay_019063_06	euxassay_019063_07	euxassay_019063_08	euxassay_019063_09

euxassay_019063_10	euxassay_019063_11	euxassay_019063_12	euxassay_019063_13	euxassay_019063_14

euxassay_019063_15	euxassay_019063_16	euxassay_019063_17	euxassay_019063_18	euxassay_019063_19

euxassay_019063_20	euxassay_019063_21	euxassay_019063_22	euxassay_019063_23	euxassay_019063_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

	strong
	moderate
	weak
	possible
	not detected

wholemount mapping

Download individual expression domains:

6502_wholemount_strong.wlz

6502_wholemount_moderate.wlz

6502_wholemount_weak.wlz

6502_wholemount_possible.wlz

6502_wholemount_not_detected.wlz

(what is wlz format?)

Download all expression domains:

EMAGE:6502_all_domains.zip

Find spatially similar wholemount expression patterns:

EMAGE spatially similar wholemount patterns

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

olfactory cortex mantle layer

weak

regional

weak expression: see section 10 11 12 15 17

trigeminal v ganglion

weak

single cell

weak expression: see section 04 05 06 07 08 09 17 18

ventral grey horn

weak

regional

weak expression: see section 10 11 12 13 14

dorsal root ganglion

weak

regional

weak expression: see section 08 09 14

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T70129
Entity Detected:	Mir680-3, microRNA 680-3 ( MGI:3629889)
Sequence:	sense strand is shown >T70129 GGGCATCTGCTGACATGGGGG
Notes:	The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-680 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:	LNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:6503 same assay
	EurExpress:euxassay_019063 same experiment
	EMAGE:6501 same embryo
	MGI:4826361 same experiment
	MGI:4826362 same experiment
	MGI:4826363 same experiment
	EMAGE:6504 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source