EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6506

Mir654 microRNA 654 ( MGI:3718556)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_019044. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_019044_01	euxassay_019044_02	euxassay_019044_03	euxassay_019044_04

euxassay_019044_05	euxassay_019044_06	euxassay_019044_07	euxassay_019044_08	euxassay_019044_09

euxassay_019044_10	euxassay_019044_11	euxassay_019044_12	euxassay_019044_13	euxassay_019044_14

euxassay_019044_15	euxassay_019044_16	euxassay_019044_17	euxassay_019044_18	euxassay_019044_19

euxassay_019044_20	euxassay_019044_21	euxassay_019044_22	euxassay_019044_23	euxassay_019044_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

	strong
	moderate
	weak
	possible
	not detected

wholemount mapping

Download individual expression domains:

6506_wholemount_strong.wlz

6506_wholemount_moderate.wlz

6506_wholemount_weak.wlz

6506_wholemount_possible.wlz

6506_wholemount_not_detected.wlz

(what is wlz format?)

Download all expression domains:

EMAGE:6506_all_domains.zip

Find spatially similar wholemount expression patterns:

EMAGE spatially similar wholemount patterns

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

diencephalon lateral wall mantle layer

weak

single cell

weak expression: see section 06 07 08 09 10 12 13 14 15 16

cerebral cortex mantle layer

weak

single cell

weak expression: see section 05 06 07 08 10 12 13 14 15 19 20

telencephalon mantle layer

weak

single cell

weak expression: see section 01 02 03 05 06 19 20 21 22 23

olfactory cortex mantle layer

moderate

single cell

moderate expression: see section 09 weak expression: see section 08 10 11 12 13 14 15

medulla oblongata alar plate mantle layer

weak

single cell

weak expression: see section 13 14 16

medulla oblongata basal plate mantle layer

weak

single cell

weak expression: see section 07 09 12 13 16

rest of cerebellum mantle layer

weak

single cell

weak expression: see section 05 06 07 09 12 13 14 16 17 18 19

pons mantle layer

weak

single cell

weak expression: see section 06 07 08 09 12 13 14 16 17

midbrain mantle layer

weak

single cell

weak expression: see section 05 06 07 08 09 10 12 13 14 15 16 17

glossopharyngeal ix ganglion

moderate

single cell

moderate expression: see section 06 weak expression: see section 07 16

trigeminal v ganglion

moderate

single cell

moderate expression: see section 06 17 20 weak expression: see section 03 04 05 07 08 15 16 18 19

spinal cord mantle layer

weak

single cell

weak expression: see section 09 10 11 12 13 14

dorsal root ganglion

moderate

single cell

moderate expression: see section 07 08 12 13 14 15 16

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T70106
Entity Detected:	Mir654, microRNA 654 ( MGI:3718556)
Sequence:	sense strand is shown >T70106 TATGTCTGCTGACCATCACCTT
Notes:	The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-654-3p was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:	LNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:6505 same embryo
	EurExpress:euxassay_019044 same experiment
	MGI:4826337 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source