Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6523

Mir291b microRNA 291b ( MGI:3718464)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6523 EMAGE:6523 EMAGE:6523 EMAGE:6523 EMAGE:6523
"Pseudo-wholemount" of euxassay_019065. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019065_01 euxassay_019065_02 euxassay_019065_03 euxassay_019065_04
EMAGE:6523 EMAGE:6523 EMAGE:6523 EMAGE:6523 EMAGE:6523
euxassay_019065_05 euxassay_019065_06 euxassay_019065_07 euxassay_019065_08 euxassay_019065_09
EMAGE:6523 EMAGE:6523 EMAGE:6523 EMAGE:6523 EMAGE:6523
euxassay_019065_10 euxassay_019065_11 euxassay_019065_12 euxassay_019065_13 euxassay_019065_14
EMAGE:6523 EMAGE:6523 EMAGE:6523 EMAGE:6523 EMAGE:6523
euxassay_019065_15 euxassay_019065_16 euxassay_019065_17 euxassay_019065_18 euxassay_019065_19
EMAGE:6523 EMAGE:6523 EMAGE:6523 EMAGE:6523 EMAGE:6523
euxassay_019065_20 euxassay_019065_21 euxassay_019065_22 euxassay_019065_23 euxassay_019065_24
EMAGE:6523 EMAGE:6523
euxassay_019065_25 euxassay_019065_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6523Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6523_wholemount_strong.wlz
6523_wholemount_moderate.wlz
6523_wholemount_weak.wlz
6523_wholemount_possible.wlz
6523_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6523_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
humerus
moderate moderate
regionalmoderate expression: see section 01 23 24 weak expression: see section 02 21 22 25 26
femur
moderate moderate
regionalmoderate expression: see section 02 03 04 23 24 weak expression: see section 22
thymus primordium
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 05 06 07 08 16 17 19
pancreas
weak weak
regionalweak expression: see section 08 09 10
dermis
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
moderate moderate
regionalmoderate expression: see section 19 20 21 weak expression: see section 05 06 22
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 11 12 14
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 11 12 14
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 17 18 19 20 21 22 23 24
cerebral cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 15 16 17 18 19 20 21 22 23
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 10 15 16
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23 24
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 14 15 16 18 19 weak expression: see section 12
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 14 15 weak expression: see section 08 09
pharyngo-tympanic tube
weak weak
regionalweak expression: see section 01 02 22 23 24
neural retina
strong strong
regionalstrong expression: see section 01 02 22 23 24 moderate expression: see section 03 weak expression: see section 25
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18 weak expression: see section 08 09 10 11
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 14
midgut
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17
meckel's cartilage
strong strong
regionalstrong expression: see section 15 16 17 moderate expression: see section 04 06 07 08 09 10 11 14 18 19 20 21 22 weak expression: see section 05 12 13
liver
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 21 22 23 moderate expression: see section 12 19 20 24
metanephros
moderate moderate
regionalmoderate expression: see section 05 06 17 18 19 weak expression: see section 07 08 09 15 16
testis
weak weak
regionalweak expression: see section 06 07 19 21
lung
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23
axial skeleton
moderate moderate
regionalmoderate expression: see section 08 11 13 14
scapula
weak weak
regionalweak expression: see section 01 02 21
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 08 09
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70365
Entity Detected:Mir291b, microRNA 291b ( MGI:3718464)
Sequence:sense strand is shown

>T70365
GATCAAAGTGGAGGCCCTCTCC
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-291b-5p was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6524 same embryo
 EMAGE:6526 same embryo
 EMAGE:6528 same embryo
 EMAGE:6527 same embryo
 EMAGE:6525 same embryo
 EurExpress:euxassay_019065 same experiment
 MGI:4826253 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS