Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6538

Mir582 microRNA 582 ( MGI:3718550)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6538 EMAGE:6538 EMAGE:6538 EMAGE:6538 EMAGE:6538
"Pseudo-wholemount" of euxassay_019041. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019041_01 euxassay_019041_02 euxassay_019041_03 euxassay_019041_04
EMAGE:6538 EMAGE:6538 EMAGE:6538 EMAGE:6538 EMAGE:6538
euxassay_019041_05 euxassay_019041_06 euxassay_019041_07 euxassay_019041_08 euxassay_019041_09
EMAGE:6538 EMAGE:6538 EMAGE:6538 EMAGE:6538 EMAGE:6538
euxassay_019041_10 euxassay_019041_11 euxassay_019041_12 euxassay_019041_13 euxassay_019041_14
EMAGE:6538 EMAGE:6538 EMAGE:6538 EMAGE:6538 EMAGE:6538
euxassay_019041_15 euxassay_019041_16 euxassay_019041_17 euxassay_019041_18 euxassay_019041_19
EMAGE:6538 EMAGE:6538 EMAGE:6538
euxassay_019041_20 euxassay_019041_21 euxassay_019041_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6538Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6538_wholemount_strong.wlz
6538_wholemount_moderate.wlz
6538_wholemount_weak.wlz
6538_wholemount_possible.wlz
6538_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6538_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
ventral grey horn
moderate moderate
single cellmoderate expression: see section 12 13 weak expression: see section 07 08 09 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70096
Entity Detected:Mir582, microRNA 582 ( MGI:3718550)
Sequence:sense strand is shown

>T70096
CCTGTTGAACAACTGAACCCAA
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-582-3p was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6540 same embryo
 EMAGE:6539 same embryo
 EurExpress:euxassay_019041 same experiment
 MGI:4826333 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS