Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6573

Mir467c microRNA 467c ( MGI:3718539)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6573 EMAGE:6573 EMAGE:6573 EMAGE:6573 EMAGE:6573
"Pseudo-wholemount" of euxassay_019038. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019038_01 euxassay_019038_02 euxassay_019038_03 euxassay_019038_04
EMAGE:6573 EMAGE:6573 EMAGE:6573 EMAGE:6573 EMAGE:6573
euxassay_019038_05 euxassay_019038_06 euxassay_019038_07 euxassay_019038_08 euxassay_019038_09
EMAGE:6573 EMAGE:6573 EMAGE:6573 EMAGE:6573 EMAGE:6573
euxassay_019038_10 euxassay_019038_11 euxassay_019038_12 euxassay_019038_13 euxassay_019038_14
EMAGE:6573 EMAGE:6573 EMAGE:6573 EMAGE:6573 EMAGE:6573
euxassay_019038_15 euxassay_019038_16 euxassay_019038_17 euxassay_019038_18 euxassay_019038_19
EMAGE:6573 EMAGE:6573 EMAGE:6573 EMAGE:6573 EMAGE:6573
euxassay_019038_20 euxassay_019038_21 euxassay_019038_22 euxassay_019038_23 euxassay_019038_24
EMAGE:6573 EMAGE:6573
euxassay_019038_25 euxassay_019038_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6573Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6573_wholemount_strong.wlz
6573_wholemount_moderate.wlz
6573_wholemount_weak.wlz
6573_wholemount_possible.wlz
6573_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6573_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 14 15 weak expression: see section 16
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 09 10 11 12 13 14 15 weak expression: see section 02 03 04 07 08 16 21 22
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 05 06
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 weak expression: see section 16 18
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 04 06 09 10 14 21 22
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 16
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 06 22
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 09 weak expression: see section 04 06 07 08 18 21 22
ventral grey horn
moderate moderate
regionalmoderate expression: see section 12 weak expression: see section 13 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 weak expression: see section 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70049
Entity Detected:Mir467c, microRNA 467c ( MGI:3718539)
Sequence:sense strand is shown

>T70049
TAAGTGCGTGCATGTATATGTG
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-467c was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6571 same embryo
 EMAGE:6572 same embryo
 EurExpress:euxassay_019038 same experiment
 MGI:4826312 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS