Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6606

Mir665 microRNA 665 ( MGI:3629896)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6606 EMAGE:6606 EMAGE:6606 EMAGE:6606 EMAGE:6606
"Pseudo-wholemount" of euxassay_019045. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019045_01 euxassay_019045_02 euxassay_019045_03 euxassay_019045_04
EMAGE:6606 EMAGE:6606 EMAGE:6606 EMAGE:6606 EMAGE:6606
euxassay_019045_05 euxassay_019045_06 euxassay_019045_07 euxassay_019045_08 euxassay_019045_09
EMAGE:6606 EMAGE:6606 EMAGE:6606 EMAGE:6606 EMAGE:6606
euxassay_019045_10 euxassay_019045_11 euxassay_019045_12 euxassay_019045_13 euxassay_019045_14
EMAGE:6606 EMAGE:6606 EMAGE:6606 EMAGE:6606 EMAGE:6606
euxassay_019045_15 euxassay_019045_16 euxassay_019045_17 euxassay_019045_18 euxassay_019045_19
EMAGE:6606 EMAGE:6606 EMAGE:6606 EMAGE:6606 EMAGE:6606
euxassay_019045_20 euxassay_019045_21 euxassay_019045_22 euxassay_019045_23 euxassay_019045_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6606Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6606_wholemount_strong.wlz
6606_wholemount_moderate.wlz
6606_wholemount_weak.wlz
6606_wholemount_possible.wlz
6606_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6606_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 12 13 14 15
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 07
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 17 18 19 20 21 22 weak expression: see section 08 16
vagus x ganglion
weak weak
regionalweak expression: see section 08 17
trigeminal v nerve
weak weak
regionalweak expression: see section 08
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 13 14 15 16 17 18 19
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 21 22 weak expression: see section 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70108
Entity Detected:Mir665, microRNA 665 ( MGI:3629896)
Sequence:sense strand is shown

>T70108
ACCAGGAGGCTGAGGTCCCT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-665 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6605 same embryo
 EMAGE:6604 same embryo
 EMAGE:6607 same embryo
 EurExpress:euxassay_019045 same experiment
 MGI:4826338 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS