Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6607

Mir668 microRNA 668 ( MGI:3629905)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6607 EMAGE:6607 EMAGE:6607 EMAGE:6607 EMAGE:6607
"Pseudo-wholemount" of euxassay_019070. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019070_01 euxassay_019070_02 euxassay_019070_03 euxassay_019070_04
EMAGE:6607 EMAGE:6607 EMAGE:6607 EMAGE:6607 EMAGE:6607
euxassay_019070_05 euxassay_019070_06 euxassay_019070_07 euxassay_019070_08 euxassay_019070_09
EMAGE:6607 EMAGE:6607 EMAGE:6607 EMAGE:6607 EMAGE:6607
euxassay_019070_10 euxassay_019070_11 euxassay_019070_12 euxassay_019070_13 euxassay_019070_14
EMAGE:6607 EMAGE:6607 EMAGE:6607 EMAGE:6607 EMAGE:6607
euxassay_019070_15 euxassay_019070_16 euxassay_019070_17 euxassay_019070_18 euxassay_019070_19
EMAGE:6607 EMAGE:6607 EMAGE:6607 EMAGE:6607 EMAGE:6607
euxassay_019070_20 euxassay_019070_21 euxassay_019070_22 euxassay_019070_23 euxassay_019070_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6607Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6607_wholemount_strong.wlz
6607_wholemount_moderate.wlz
6607_wholemount_weak.wlz
6607_wholemount_possible.wlz
6607_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6607_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 02 03 04 weak expression: see section 05 06 07 08 14 15 16 17 19 20 21 22 23 24
humerus
moderate moderate
regionalmoderate expression: see section 01 02 23 24 weak expression: see section 03 19 22
fibula
weak weak
regionalweak expression: see section 19 21 22
tibia
weak weak
regionalweak expression: see section 21
femur
weak weak
regionalweak expression: see section 01 02 03 04 16 17 18 19 21
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 09 15 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 18
ventral grey horn
weak weak
regionalweak expression: see section 10 11 12 13 14 15
otic capsule
weak weak
regionalweak expression: see section 08 09 15 16
neural retina
weak weak
regionalweak expression: see section 01 21 22
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 02 03 04 07 08 09 11 12 14 15 16 weak expression: see section 05 06 10 17 18 19 20 21
axial skeleton
weak weak
regionalweak expression: see section 08 11 12 13 14 15 16 17 18
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 09 10 11 12 13 14 15
exoccipital bone
moderate moderate
regionalmoderate expression: see section 04 20 weak expression: see section 02 05 06 21 22
temporal bone
moderate moderate
regionalmoderate expression: see section 04 23 weak expression: see section 01 02 03 05 06 19 20 21 22 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 04 16 23 weak expression: see section 01 02 03 05 06 10 11 12 13 14 17 18 19 20 21 22 24
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
scapula
moderate moderate
regionalmoderate expression: see section 03 04 22 23 24
pelvic girdle skeleton
weak weak
regionalweak expression: see section 06 07 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70112
Entity Detected:Mir668, microRNA 668 ( MGI:3629905)
Sequence:sense strand is shown

>T70112
CTTGGGCTGGGTGGCAGGTGTCA
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-668 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6605 same embryo
 EMAGE:6606 same embryo
 EMAGE:6604 same embryo
 EurExpress:euxassay_019070 same experiment
 MGI:4826339 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS