Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6622

Mir218-2 microRNA 218-2 ( MGI:3618752)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6622 EMAGE:6622 EMAGE:6622 EMAGE:6622 EMAGE:6622
"Pseudo-wholemount" of euxassay_019036. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019036_01 euxassay_019036_02 euxassay_019036_03 euxassay_019036_04
EMAGE:6622 EMAGE:6622 EMAGE:6622 EMAGE:6622 EMAGE:6622
euxassay_019036_05 euxassay_019036_06 euxassay_019036_07 euxassay_019036_08 euxassay_019036_09
EMAGE:6622 EMAGE:6622 EMAGE:6622 EMAGE:6622 EMAGE:6622
euxassay_019036_10 euxassay_019036_11 euxassay_019036_12 euxassay_019036_13 euxassay_019036_14
EMAGE:6622 EMAGE:6622 EMAGE:6622 EMAGE:6622 EMAGE:6622
euxassay_019036_15 euxassay_019036_16 euxassay_019036_17 euxassay_019036_18 euxassay_019036_19
EMAGE:6622 EMAGE:6622 EMAGE:6622 EMAGE:6622 EMAGE:6622
euxassay_019036_20 euxassay_019036_21 euxassay_019036_22 euxassay_019036_23 euxassay_019036_24
EMAGE:6622 EMAGE:6622
euxassay_019036_25 euxassay_019036_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6622Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6622_wholemount_strong.wlz
6622_wholemount_moderate.wlz
6622_wholemount_weak.wlz
6622_wholemount_possible.wlz
6622_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6622_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 09 17 18 19 weak expression: see section 05 06 07 08 10 11 12 20 21 22 23 24 25 26
humerus
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 03 04 05 24 25 26
fibula
weak weak
regionalweak expression: see section 02 03 04
tibia
weak weak
regionalweak expression: see section 02 03
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 16 17 moderate expression: see section 09 10
pons mantle layer
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 08 09 18
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 12 14 15 weak expression: see section 13
abducent vi nerve
weak weak
regionalweak expression: see section 12 15
ventral grey horn
strong strong
regionalstrong expression: see section 13 14 15 16 17 moderate expression: see section 11 12
otic capsule
moderate moderate
regionalmoderate expression: see section 10 17 18 weak expression: see section 09
hyoid
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 11 12 13 14 15
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 05 09 10 17 18 weak expression: see section 04 06 07 08 11 12 13 14 16 19 20 21 22 23 24
axial skeleton
moderate moderate
regionalmoderate expression: see section 09 17 18 19 weak expression: see section 10 11 12 13 14 15 16
basisphenoid bone
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16 17 19
orbito-sphenoid
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 17
viscerocranium
weak weak
regionalExpression in the turbinate bone.
scapula
weak weak
regionalweak expression: see section 02 03 04 05 23 24 25
pelvic girdle skeleton
weak weak
regionalweak expression: see section 11 12 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70343
Entity Detected:Mir218-2, microRNA 218-2 ( MGI:3618752)
Sequence:sense strand is shown

>T70343
TTGTGCTTGATCTAACCATGT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-218 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6623 same assay
 EurExpress:euxassay_019036 same experiment
 MGI:4826249 same experiment
 MGI:4826248 same experiment
 EMAGE:6621 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS