EMAGE mouse gene expression spatial database

EMAGE:665

Lefty2 left-right determination factor 2 ( MGI:2443573)
TS09 (6.75 dpc)
in situ hybridisation

Data Images


Fig 5D Perea-Gomez et al., 1999 [PMID:10498685] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright

Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

primitive streak

detected

regional

Expression is detected in the middle part of the primitive streak of a wild-type embryo and in mesoderm cells emerging from it

embryo mesoderm

detected

regional

Expression is detected in the middle part of the primitive streak of a wild-type embryo and in mesoderm cells emerging from it

Annotation Validation:

EMAGE Editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	MGI:1289467
Entity Detected:	Lefty2, left-right determination factor 2 ( MGI:2443573)
Sequence:	sense strand is shown >MGI:1289467 GCCTTCGACGTGACCGAGGCCGTGAACTTCTGGCAGCAGCTGAGCCGGCCGAGGCAGCCGCTGCTGCTCC AGGTGTCGGTGCAGAGGGAGCATCTGGGGCCGGGAACCTGGAGCTCACACAAGTTGGTTCGTTTCGCGGC GCAGGGGACGCCGGATGGCAAGGGGCAGGGCGAGCCACAGCTGGAGCTGCACACGCTGGACCTCAAGGAC TATGGAGCTCAAGGCAATTGTGACCCCGAGGCACCAGTGACTGAAGGCACCCGATGCTGTCGCCAGGAGA TGTACCTGGACCTGCAGGGGATGAAGTGGGCCGAGAACTGGATCCTAGAACCGCCAGGGTTCCTGACATA TGAATGTGTGGGCAGCTGCCTGCAGCTACCGGAGTCCCTGACCAGCAGGTGGCCATTTCTGGGGCCTCGG CAGTGTGTCGCCTCAGAGATGACCTCCCTGCCCATGATTGTCAGCGTGAAGGAGGGAGGCAGGACCAGG
	nt 617 - nt 1105 of D83921.1
Notes:	The probe used in this study by Perea-Gomez et al., 1999 [PMID:10498685] is described as the "lefty2 probe used by Meno et al, 1996 [PMID:8610011] ". Meno describe the probe as an "AatI 0.5-kb fragment from a cDNA clone" (shown schematically in Fig 1a therein). In that paper, Meno et al call this gene lefty which is subsequently referred to in their next paper (Meno et al, 1997 [PMID:9348041] as lefty-2. Nucleotide sequence comparisons of the clone originally described by Meno et al, 1996 [PMID:8610011] (shown in Fig 1a therein and submitted to GenBank as D83921) however identify it as lefty1 (Ebaf).
Chemistry:	RNA
Strand:	antisense

Specimen

Procedures

General Information

Authors:	Perea-Gomez et al., 1999 [PMID:10498685] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	non-screen
References:	[ PMID:10498685] Perea-Gomez A, Shawlot W, Sasaki H, Behringer RR, Ang S 1999 HNF3beta and Lim1 interact in the visceral endoderm to regulate primitive streak formation and anterior-posterior polarity in the mouse embryo. Development (1999):4499-511
	[ doi:10.1038/381151a0] [ PMID:8610011] Meno C, Saijoh Y, Fujii H, Ikeda M, Yokoyama T, Yokoyama M, Toyoda Y, Hamada H 1996 Left-right asymmetric expression of the TGF beta-family member lefty in mouse embryos. Nature (381):151-5
	[ doi:10.1046/j.1365-2443.1997.1400338.x] [ PMID:9348041] Meno C, Ito Y, Saijoh Y, Matsuda Y, Tashiro K, Kuhara S, Hamada H 1997 Two closely-related left-right asymmetrically expressed genes, lefty-1 and lefty-2: their distinct expression domains, chromosomal linkage and direct neuralizing activity in Xenopus embryos. Genes Cells (2):513-24
Links:	MGI:1346295 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source