Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6657

Cldn7 claudin 7 ( MGI:1859285)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6657 EMAGE:6657 EMAGE:6657 EMAGE:6657 EMAGE:6657
"Pseudo-wholemount" of euxassay_002232. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002232_01 euxassay_002232_02 euxassay_002232_03 euxassay_002232_04
EMAGE:6657 EMAGE:6657 EMAGE:6657 EMAGE:6657 EMAGE:6657
euxassay_002232_05 euxassay_002232_06 euxassay_002232_07 euxassay_002232_08 euxassay_002232_09
EMAGE:6657 EMAGE:6657 EMAGE:6657 EMAGE:6657 EMAGE:6657
euxassay_002232_10 euxassay_002232_11 euxassay_002232_12 euxassay_002232_13 euxassay_002232_14
EMAGE:6657 EMAGE:6657 EMAGE:6657 EMAGE:6657 EMAGE:6657
euxassay_002232_15 euxassay_002232_16 euxassay_002232_17 euxassay_002232_18 euxassay_002232_19
EMAGE:6657 EMAGE:6657 EMAGE:6657 EMAGE:6657 EMAGE:6657
euxassay_002232_20 euxassay_002232_21 euxassay_002232_22 euxassay_002232_23 euxassay_002232_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6657Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6657_wholemount_strong.wlz
6657_wholemount_moderate.wlz
6657_wholemount_weak.wlz
6657_wholemount_possible.wlz
6657_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6657_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 09 17 18 19
foregut-midgut junction
strong strong
regionalstrong expression: see section 09 10 11 12
pancreas
moderate moderate
regionalmoderate expression: see section 06 07 08 11 12 13 weak expression: see section 04 05
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 14 15 16 17 18
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07
hindgut
strong strong
regionalstrong expression: see section 09 10 11 12
rectum
strong strong
regionalstrong expression: see section 09
midgut
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14
oral epithelium
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 weak expression: see section 10
bladder
moderate moderate
regionalmoderate expression: see section 09 10 11
kidney calyx
moderate moderate
regionalmoderate expression: see section 02 03 04 06 07 13 14 16 17
kidney pelvis
moderate moderate
regionalmoderate expression: see section 05 15
male reproductive system
moderate moderate
regionalmoderate expression: see section 09 10
urethra of male
moderate moderate
regionalmoderate expression: see section 09 10
lung
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 21 22 23 weak expression: see section 18 19 20
trachea
strong strong
regionalstrong expression: see section 11 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3033
Entity Detected:Cldn7, claudin 7 ( MGI:1859285)
Sequence:sense strand is shown

>T3033
TGGCCTCGAGCCAGAATTCGTCGAATCTGCCGCCGCACCGCCAGCTCCCTGTGCCGCGCACCGCAGCCTG
GGGCCCAAGGGCCCGCATACTTTCTGGGGGCCACGCCCTAACGGCCCCTCCACTTCTTTGGGTAGTCTCG
GAGCACGCCGGTAGGAACCGCCCGGCCTTCGGGGACCGCTTTTGTCTGGAACCAGTCCTTCGGGCGAAGC
CGGTTCCCTCTGCTGTGAGAGTGTCGCTTCACCGGAGGGGACGATTTGTGTTTACCTCGGTTAACAAGAT
TTGTAGTTACCCGGTCCAAAAAAAAATCTCTTTCTCCTTTGGGTGACTTAAATCTCTATCCAAATTTTCT
TGTGTTGCTGCTCCCCGGATTTTTGTTTTTTTGTTTTTTTGCTTTACTGTAGGGTCGCCCTCCCGGCGCG
TCCCGTCTTTTCTGAGACAAGGAAATGGCCAACTCGGGCCTGCAACTGCTGGGCTTTTCAATGGCCATGC
TTGGCTGGGTGGGCCTGATAGCGAGCACTGCCATCCCTCAGTGGCAGATGAGCTCC
Notes:The probe template was PCR amplified from IMAGE:1545928 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1545928 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6656 same embryo
 EMAGE:6658 same embryo
 EMAGE:6659 same embryo
 EurExpress:euxassay_002232 same experiment
 MGI:4823915 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS