Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6758

Mybpc1 myosin binding protein C, slow-type ( MGI:1336213)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6758 EMAGE:6758 EMAGE:6758 EMAGE:6758 EMAGE:6758
"Pseudo-wholemount" of euxassay_007351. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007351_01 euxassay_007351_02 euxassay_007351_03 euxassay_007351_04
EMAGE:6758 EMAGE:6758 EMAGE:6758 EMAGE:6758 EMAGE:6758
euxassay_007351_05 euxassay_007351_06 euxassay_007351_07 euxassay_007351_08 euxassay_007351_09
EMAGE:6758 EMAGE:6758 EMAGE:6758 EMAGE:6758 EMAGE:6758
euxassay_007351_10 euxassay_007351_11 euxassay_007351_12 euxassay_007351_13 euxassay_007351_14
EMAGE:6758 EMAGE:6758 EMAGE:6758 EMAGE:6758 EMAGE:6758
euxassay_007351_15 euxassay_007351_16 euxassay_007351_17 euxassay_007351_18 euxassay_007351_19
EMAGE:6758
euxassay_007351_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6758Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6758_wholemount_strong.wlz
6758_wholemount_moderate.wlz
6758_wholemount_weak.wlz
6758_wholemount_possible.wlz
6758_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6758_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 20
upper leg muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 15 16 17 18 19 20
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
foot
strong strong
regionalstrong expression: see section 02 14 15 20 moderate expression: see section 16 17 18 19
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 19 20
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 08 09 10 13 14 15 moderate expression: see section 07
telencephalon ventricular layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 15 16 17 18 19 20
medulla oblongata basal plate
strong strong
regionalstrong expression: see section 04
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 16 17 18 19 20
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
pons mantle layer
strong strong
regionalstrong expression: see section 10 11
eye skeletal muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 16 17 18 19 20
tongue muscle
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3261
Entity Detected:Mybpc1, myosin binding protein C, slow-type ( MGI:1336213)
Sequence:sense strand is shown

>T3261
GCAAAAAATGGCCTCCCTGTTCAGGAGGGTGAGCGTCTGAAGGTTGTTCACAAGGGAAGAATCCACAAGT
TAGTCATAGCCAATGCTCTCATTGAAGATGAAGGTGAATATGTATTTACACCAGATGCCTACAATGTTCC
TTTGTCTGCCAAAGTTCATGTCATCGACCCTCCCAAGATCATCCTGGATGGCCTGGATGCTGATAACACA
GTGACAGTGATAGCTGGAAGCAAGCTTCGCCTGGAGATTCCTGTCACAGGGGAACCACCTCCCAAAGCCA
TCTGGAGCCGAGCAGATAAGGCTATTATGGAAGGCAGTGGTCGGATCAGGGCAGAATCCTACCCTGACAG
CAGCACACTGGTCATTGACGTGGCAGAGAGAGACGACTCTGGTGTGTACAACATAAATCTGAAAAATGAG
GCTGGAGAAGCACATGCAAGCATCAAGATTAAGGTTGTGGATATCCCTGATCCTCCAGTGGCACCAAATG
TGACAGAAGTGGGAGATGACTGGTGCATCATGAACTGGGAGCCTCCT
Notes:The probe template was PCR amplified from IMAGE:2779958 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2779958 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4826529 same experiment
 EurExpress:euxassay_007351 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS