Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6887

Zfp36l1 zinc finger protein 36, C3H type-like 1 ( MGI:107946)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6887 EMAGE:6887 EMAGE:6887 EMAGE:6887 EMAGE:6887
"Pseudo-wholemount" of euxassay_007310. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007310_01 euxassay_007310_02 euxassay_007310_03 euxassay_007310_04
EMAGE:6887 EMAGE:6887 EMAGE:6887 EMAGE:6887 EMAGE:6887
euxassay_007310_05 euxassay_007310_06 euxassay_007310_07 euxassay_007310_08 euxassay_007310_09
EMAGE:6887 EMAGE:6887 EMAGE:6887 EMAGE:6887 EMAGE:6887
euxassay_007310_10 euxassay_007310_11 euxassay_007310_12 euxassay_007310_13 euxassay_007310_14
EMAGE:6887 EMAGE:6887 EMAGE:6887 EMAGE:6887 EMAGE:6887
euxassay_007310_15 euxassay_007310_16 euxassay_007310_17 euxassay_007310_18 euxassay_007310_19
EMAGE:6887 EMAGE:6887 EMAGE:6887
euxassay_007310_20 euxassay_007310_21 euxassay_007310_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6887Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6887_wholemount_strong.wlz
6887_wholemount_moderate.wlz
6887_wholemount_weak.wlz
6887_wholemount_possible.wlz
6887_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6887_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
body cavity or lining
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
limb
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
mesenchyme
strong strong
regionalstrong expression: see section 01 02 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
gland
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
alimentary system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
integumental system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13
diencephalon meninges
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17
telencephalon mantle layer
strong strong
single cellstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata alar plate mantle layer
strong strong
single cellstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 10 11 12
hindbrain meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
cerebellum intraventricular portion mantle layer
strong strong
single cellstrong expression: see section 07 08 09 10 11 12 13 14 not examined expression: see section 02 03 04 05 06 15 16 17 18 19
cerebellum intraventricular portion ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 not examined expression: see section 01 02 03 04 05 06 15 16 17 18 19
rest of cerebellum mantle layer
strong strong
single cellstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
pons mantle layer
strong strong
single cellstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
pons ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain meninges
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
strong strong
single cellstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
midbrain ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15
spinal cord mantle layer
strong strong
single cellstrong expression: see section 08 09 10 11 12 13 14 15
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 11 12 13
spinal cord meninges
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17
sensory organ system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
cardiovascular system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
urinary system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
reproductive system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
respiratory system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
tail
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3012
Entity Detected:Zfp36l1, zinc finger protein 36, C3H type-like 1 ( MGI:107946)
Sequence:sense strand is shown

>T3012
TGGCCTCGAGCCAGATTCGGCACGAGGGACATCTTAAAAATGACAACAAATGAGAGAAAAGCTAAAAACA
ACAAAAAAAAAACATGTAAGGGGTGAGCAGTTAATGGTCTGCATTCCACATACAATATCTGTGTAAAACG
ATTTCCTGTAGAAGTAGCTTTAATGGATTTTGCTCTAGAATACCTTAGGTCTACCTTAGAGCCCCCACAC
AATGCTTTTTTCCCTGGGTTTAAACTTCATCTAACTTTCAGAAATTGGAGAGCAAAAATGTTGCTTATCA
CTGCACATCAATATAAAAAAGCTTATTTAACTTATCAAAACGTATTTATTGCCAAACTATGCTTTTTTTG
TTAATTTTGTTCATATTTATCGGGATGACATATCCATAGAATATATTCTTTTATGTTAAATTATGATCTT
CATATTAATCTTAAAATTTTGTGACGTGTCTTTCCTTTTTTCCACAGTTTTAATATATTATTCTTCAACA
ACATTTTTGTAACTTTACACTTTTTTTGGTTATTTTATTTTAAAAAAATGAAAAATTAATTTAAAAAAAT
GCAAAAAAC
Notes:The probe template was PCR amplified from IMAGE:1533448 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1533448 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6886 same embryo
 EurExpress:euxassay_007310 same experiment
 MGI:4829304 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS