Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:699

T brachyury ( MGI:98472)
TS09 (6.5 dpc)
in situ hybridisation

Data Images
EMAGE:699
Figure 1G of Thomas et al., 1998 [PMID:9389666] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
***NOTE - THIS EMBRYO IS STAINED FOR BOTH T AND HEX*** The white arrow indicates T expression; black arrow indicates Hex expression. Only the T expression doamin has been spatially annotated in this EMAGE entry.
Expression Pattern Description
Spatial Annotation:
EMAGE:699Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
699_wholemount_strong_3D_1.wlz
699_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:699_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
primitive streak
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:2449091
Entity Detected:T, brachyury ( MGI:98472)
Sequence:sense strand is shown

>MGI:2449091
CCTGGAATTCGTCCACCCCCTGTCCTACTTTAGTGAGACACAAGGTACACCTCTAATGTCCTCCCTTGTT
GCCTTAGAGTAGTTAACTTTGAGGACAGAAAAAAGCATAGCCAGAAGATTGTAACTGAACCGTCAACTGT
TCTGCCCTTGGAACATGCCTACTTTAAGCACACGTAGCTTTTTGTGTTGGGAAGTCAACTGTATGGATAC
TTTTCTGTTGACAAAGTAGCCAAAGACAATCTGCAGAAAGTGTTTTCTGCATAATAAAGGCAATATATAG
CACCTGG
nt 1760 - nt 2046 of X51683.1
Notes:The T probe used in this study by Thomas et al., 1998 [PMID:9389666] was referenced as that used by Thomas & Beddington, 1996 [PMID:8939602] , and was previously described by Wilkinson et al., 1990 [PMID:1689462] as "corresponding to residues from residue 1,760 to the end residue in the 3'-untranslated region of T-gene RNA (Herrmann et al., 1990 [PMID:2154694] )."
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:6.5 dpc
Theiler Stage:TS09
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Thomas et al., 1998 [PMID:9389666] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:9389666] Thomas PQ, Brown A, Beddington RS 1998 Hex: a homeobox gene revealing peri-implantation asymmetry in the mouse embryo and an early transient marker of endothelial cell precursors. Development (125):85-94
 [ doi:10.1016/S0960-9822(96)00753-1] [ PMID:8939602] Thomas P, Beddington R 1996 Anterior primitive endoderm may be responsible for patterning the anterior neural plate in the mouse embryo. Curr Biol (6):1487-96
 [ doi:10.1038/343657a0] [ PMID:1689462] Wilkinson DG, Bhatt S, Herrmann BG 1990 Expression pattern of the mouse T gene and its role in mesoderm formation. Nature (343):657-9
 [ doi:10.1038/343617a0] [ PMID:2154694] Herrmann BG, Labeit S, Poustka A, King TR, Lehrach H 1990 Cloning of the T gene required in mesoderm formation in the mouse. Nature (343):617-22
Links:MGI:1306928 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI