Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7187

H2-Oa histocompatibility 2, O region alpha locus ( MGI:95924)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7187 EMAGE:7187 EMAGE:7187 EMAGE:7187 EMAGE:7187
"Pseudo-wholemount" of euxassay_007269. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007269_01 euxassay_007269_02 euxassay_007269_03 euxassay_007269_04
EMAGE:7187 EMAGE:7187 EMAGE:7187 EMAGE:7187 EMAGE:7187
euxassay_007269_05 euxassay_007269_06 euxassay_007269_07 euxassay_007269_08 euxassay_007269_09
EMAGE:7187 EMAGE:7187 EMAGE:7187 EMAGE:7187 EMAGE:7187
euxassay_007269_10 euxassay_007269_11 euxassay_007269_12 euxassay_007269_13 euxassay_007269_14
EMAGE:7187 EMAGE:7187 EMAGE:7187 EMAGE:7187 EMAGE:7187
euxassay_007269_15 euxassay_007269_16 euxassay_007269_17 euxassay_007269_18 euxassay_007269_19

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7187Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7187_wholemount_strong.wlz
7187_wholemount_moderate.wlz
7187_wholemount_weak.wlz
7187_wholemount_possible.wlz
7187_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7187_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
sublingual gland primordium
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 16 17 18 weak expression: see section 15
vibrissa
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 04 05 18 19
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 07 08 09 moderate expression: see section 10 11 12 13 14 15 16
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 moderate expression: see section 10 11 12 13 14 15 16 17 18 19
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16
pons mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 moderate expression: see section 10 11 12 13 14 15 16 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 16 17 18 19 weak expression: see section 07 08 15
ventral grey horn
strong strong
regionalstrong expression: see section 10 11 12 13 14 15
cornea
moderate moderate
regionalmoderate expression: see section 01 02 03
palatal shelf
weak weak
regionalweak expression: see section 09 10 11 12 13
bladder
weak weak
regionalweak expression: see section 09 10 11 12 13
metanephros
moderate moderate
regionalmoderate expression: see section 06 16 17 18 weak expression: see section 07 08 14 15
male reproductive system
weak weak
regionalweak expression: see section 10 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1912
Entity Detected:H2-Oa, histocompatibility 2, O region alpha locus ( MGI:95924)
Sequence:sense strand is shown

>T1912
TGGCCTCGAGCCAGATTCGGACGAGGCGCCTGTGATCAATGTCACCTGGCTGCGCAACAGCCAGCCCATC
ACTAAGGGAGTGGCCCAGACCAGCTTCTACTCTCAGCCTAACCACAGGTTCCGGAAGTTCCACTACCTGA
CCTTCGTGCCCTCTGCGGAGGATGTGTACGACTGCAAGGTGGAACACTGGGGCCTGGATACACCGCTCCT
CCAGCACTGGGAGCCCCAAGTGCTTACCCCACCACCGGACACCATAGAGACCCTGATCTGTGGCCTGGGC
CTGGTTCTCGGCCTTATGGGCTGCCTCCTGGGCACCGTGCTCATGATCACAGGCACACGCAGGCCCAGTA
TCCGCAGGTAACTTCTCTTCTGAGAAACCCTTGAGAGATGATTCCTGGCGGACTTCTGGAAGCTTCTGCG
TGCTCAGCGGCAGCCTGTGACAGTGTTGACCTCGAGTGGCATCAACCTCTGTTCACCAAATCCCAGGAGA
ACATTGTGGGCGCAGTCTCCTGCCCTGGTACCCCATTTCACTCACAGCTCCAG
Notes:The probe template was PCR amplified from IMAGE:622618 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:622618 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7186 same embryo
 EurExpress:euxassay_007269 same experiment
 MGI:4825308 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS