Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:74

En2 engrailed 2 ( MGI:95390)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:74
Figure 3I of Suda et al., 2001 [PMID:11493561] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologisis Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:74Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
74_wholemount_strong_3D_1.wlz
74_wholemount_moderate_3D_1.wlz
74_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:74_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
future midbrain
detected detected
gradedGradient of expression over the caudal mesencephalon and rhombomere 1 (r1).
rhombomere 01
detected detected
gradedGradient of expression over the caudal mesencephalon and rhombomere 1 (r1).
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1331401
Entity Detected:En2, engrailed 2 ( MGI:95390)
Sequence:sense strand is shown

>MGI:1331401
AGATCTTTCTTTCATTTTTCTTTTCTCCCTTTTTTTAATCCCTTAAACTCCTTATGGGACATTGGACACT
TCTTCCCCCGAAAGAAAAAAAATTTAAAACAACTTGCTGAAGTCCAAAGATTTTTATTGCTGCATTTCAC
AGGACTGTGAACCGAATAAATAGCTCCTATTTGGTCTGTGGGCTCTGCCGCTTGCTTTGTGCTGGCTCGG
ACAGGTACTGTAGGAAGCGCCAGCCAGCGTGGTGATGGGAGAGCT
nt 1315 - nt 1569 of NM_010134.1
Notes:Probe used in this study by Suda et al., 2001 [PMID:11493561] is indicated as being described by Davis et al., 1988 [PMID:2454212] who in turn refer to Davis & Joyner, 1988 [PMID:2907320] ie. a "250 bp BglII/SstI fragment" within the 3' UTR (see Fig 1 in the latter).
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Staining procedure:undefined
General Information
Authors:Suda et al., 2001 [PMID:11493561] Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:11493561] Suda Y, Hossain ZM, Kobayashi C, Hatano O, Yoshida M, Matsuo I, Aizawa S 2001 Emx2 directs the development of diencephalon in cooperation with Otx2. Development (128):2433-50
 [ doi:10.1101/gad.2.3.361] [ PMID:2454212] Davis CA, Noble-Topham SE, Rossant J, Joyner AL 1988 Expression of the homeo box-containing gene En-2 delineates a specific region of the developing mouse brain. Genes Dev (2):361-71
 [ doi:10.1101/gad.2.12b.1736] [ PMID:2907320] Davis CA, Joyner AL 1988 Expression patterns of the homeo box-containing genes En-1 and En-2 and the proto-oncogene int-1 diverge during mouse development. Genes Dev (2):1736-44
Links:MGI:2148284 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI