Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:771

Fgf8 fibroblast growth factor 8 ( MGI:99604)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:771
Figure 4G of Wassarman et al., 1997 [PMID:9247335] . Copyright: This image is from Development and is displayed with permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:771EMAGE:771Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
771_voxel_strong_3D_1.wlz
771_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:771_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hindbrain
detected detected
regionalExpression is noted in a sharp transverse stripe at the anterior boundary of the hindbrain.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1334951
Entity Detected:Fgf8, fibroblast growth factor 8 ( MGI:99604)
Sequence:sense strand is shown

>MGI:1334951
AGAACGCCAAGTACGAGGGCTGGTACATGGCCTTTACCCGCAAGGGCCGGCCCCGCAAGGGCTCCAAGAC
GCGCCAGCATCAGCGCGAGGTGCACTTCATGAAGCGCCTGCCGCGGGGCCACCACACCACCGAGCAGAGC
CTGCGCTTCGAGTTCCTCAACTACCCGCCCTTCACGCGCAGCCTGCGCGGCAGCCAGAGGACTTGGGCCC
CGGAGCCCCGATAGGCGCTCGCCCAGCTCCTCCCCACCCAGCCGGCCGAGGAATCCAGCGGGAGCTCGGC
GGCACAGCAAAGGGGAGGGGCTGGGGAGCTGCCTTCTAGTTGTGCATATTGTTTGCTGTTGGGTTTTTTT
GTTTTTTGTTTTTTGTTTTTGTTTTTTGTTTTTTAAACAAAAGAGAGGCG
nt 598 - nt 997 of D12482.1
Notes:The probe used in this study by Wassarman et al., 1997 [PMID:9247335] was originally described in Crossley & Martin, 1995 [PMID:7768185] as a "400nt cDNA probe containing the 3'UTR and C-terminal coding sequences up to the PstI site at nt position 598 in AIGF (Tanaka et al, 1992 [PMID:1409588] )".
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount plus section of wholemount
Procedures
Embedding:paraffin
Staining procedure:alkaline phosphatase + BMpurple
General Information
Authors:Wassarman et al., 1997 [PMID:9247335] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:9247335] Wassarman KM, Lewandoski M, Campbell K, Joyner AL, Rubenstein JL, Martinez S, Martin GR 1997 Specification of the anterior hindbrain and establishment of a normal mid/hindbrain organizer is dependent on Gbx2 gene function. Development (124):2923-34
 [ PMID:7768185] Crossley PH, Martin GR 1995 The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development (121):439-51
 [ doi:10.1073/pnas.89.19.8928] [ PMID:1409588] Tanaka A, Miyamoto K, Minamino N, Takeda M, Sato B, Matsuo H, Matsumoto K 1992 Cloning and characterization of an androgen-induced growth factor essential for the androgen-dependent growth of mouse mammary carcinoma cells. Proc Natl Acad Sci U S A (89):8928-32
Links:MGI:1331431 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI