Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:774

Otx2 orthodenticle homolog 2 (Drosophila) ( MGI:97451)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:774
Figure 4E of Wassarman et al., 1997 [PMID:9247335] . Copyright: This image is from Development and is displayed with permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: two stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Solid arrowhead indicates the anterior end of the Otx2 expression domain in the roof of the hindbrain that marks the prospective choroid plexus.
Expression Pattern Description
Spatial Annotation:
EMAGE:774EMAGE:774Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
774_voxel_strong_3D_1.wlz
774_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:774_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hindbrain
detected detected
regionalArrowhead indicates the anterior end of expression in the roof of the hindbrain that marks the prospective choroid plexus.
4th ventricle
detected detected
regionalArrowhead indicates the anterior end of expression in the roof of the hindbrain that marks the prospective choroid plexus.
midbrain
detected detected
regionalArrowhead indicates the anterior end of expression in the roof of the hindbrain that marks the prospective choroid plexus.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1331375
Entity Detected:Otx2, orthodenticle homolog 2 (Drosophila) ( MGI:97451)
Sequence:sense strand is shown

>MGI:1331375
GCCAGTTCAGTCCCCCCTCTAGTACCTCAGTCCCAACCATTGCCAGCAGCAGTGCTCCAGTGTCTATCTG
GAGCCCAGCGTCCATCTCCCCACTGTCTGACCCCTTGTCCACTTCCTCCTCCTGCATGCAGAGGTCCTAT
CCCATGACCTATACTCAGGCTTCAGGTTATAGTCAAGGCTATGCTGGCTCAACTTCCTACTTTGGGGGCA
TGGACTGTGGATCTTATTTGACCCCTATGCATCACCAGCTTCCTGGACCAGGGG
nt 718 - nt 981 of NM_144841.1
Notes:The probe used in this study by Wassarman et al., 1997 [PMID:9247335] was originally described in Simeone et al., 1993 [PMID:8101484] as "a 263 nucleotide HaeIII fragment" (see Figure 1a therein).
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:section
Procedures
Embedding:paraffin
Staining procedure:alkaline phosphatase + BMpurple
General Information
Authors:Wassarman et al., 1997 [PMID:9247335] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:9247335] Wassarman KM, Lewandoski M, Campbell K, Joyner AL, Rubenstein JL, Martinez S, Martin GR 1997 Specification of the anterior hindbrain and establishment of a normal mid/hindbrain organizer is dependent on Gbx2 gene function. Development (124):2923-34
 [ PMID:8101484] Simeone A, Acampora D, Mallamaci A, Stornaiuolo A, D'Apice MR, Nigro V, Boncinelli E 1993 A vertebrate gene related to orthodenticle contains a homeodomain of the bicoid class and demarcates anterior neuroectoderm in the gastrulating mouse embryo. EMBO J (12):2735-47
Links:MGI:1331426 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI