Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7832

Adam23 a disintegrin and metallopeptidase domain 23 ( MGI:1345162)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7832 EMAGE:7832 EMAGE:7832 EMAGE:7832 EMAGE:7832
"Pseudo-wholemount" of euxassay_007602. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007602_01 euxassay_007602_02 euxassay_007602_03 euxassay_007602_04
EMAGE:7832 EMAGE:7832 EMAGE:7832 EMAGE:7832 EMAGE:7832
euxassay_007602_05 euxassay_007602_06 euxassay_007602_07 euxassay_007602_08 euxassay_007602_09
EMAGE:7832 EMAGE:7832 EMAGE:7832 EMAGE:7832 EMAGE:7832
euxassay_007602_10 euxassay_007602_11 euxassay_007602_12 euxassay_007602_13 euxassay_007602_14
EMAGE:7832 EMAGE:7832 EMAGE:7832 EMAGE:7832 EMAGE:7832
euxassay_007602_15 euxassay_007602_16 euxassay_007602_17 euxassay_007602_18 euxassay_007602_19
EMAGE:7832 EMAGE:7832 EMAGE:7832 EMAGE:7832
euxassay_007602_20 euxassay_007602_21 euxassay_007602_22 euxassay_007602_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7832Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7832_wholemount_strong.wlz
7832_wholemount_moderate.wlz
7832_wholemount_weak.wlz
7832_wholemount_possible.wlz
7832_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7832_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
sublingual gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 13 14 weak expression: see section 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 05 15
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 weak expression: see section 15
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 weak expression: see section 08 15 16 17
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 weak expression: see section 03 04 05 07 08 10 16
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 15
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 16 17 weak expression: see section 18
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 15 16 17 18 19 20 21
vagus x ganglion
strong strong
regionalstrong expression: see section 07 16
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 15 18 moderate expression: see section 16 17
trigeminal v nerve maxillary division
moderate moderate
regionalmoderate expression: see section 04 05 16 17 18 19
ventral grey horn
moderate moderate
regionalmoderate expression: see section 10 14 15 weak expression: see section 11 12 13
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 14 15 16 17
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 20 21 22 23
tongue muscle
weak weak
regionalweak expression: see section 08 09 10 11 12 13
mandible
moderate moderate
regionalmoderate expression: see section 02 weak expression: see section 03 05 06 07 15 16 17 18 19 20
maxilla
weak weak
regionalweak expression: see section 06 07 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35882
Entity Detected:Adam23, a disintegrin and metallopeptidase domain 23 ( MGI:1345162)
Sequence:sense strand is shown

>T35882
GTGTGTTCTCGAATAAGAGGGGTTGGTGTGAATGAGTATGGTCTTCCAATGGCGGTGGCACAAGTATTAT
CACAGAGCCTGGCTCAAAACCTTGGAATCCAGTGGGAACCTTCGAGCAGGAAGCCAAAATGTGAATGCAT
AGAGTCCTGGGGCGGCTGCATCATGGAAGAAACAGGGGTGTCCCACTCTCGAAAGTTCTCAAAGTGCAGC
ATTTTGGAGTACAGAGACTTTTTACAGAGAGGTGGCGGAGCATGTCTTTTCAATAGGCCAACTAAGCTGT
TTGAGCCCACGGAATGTGGAAATGGATATGTGGAGGCCGGGGAGGAATGCGACTGTGGTTTCCATGTGGA
ATGCTATGGAGTTTGCTGTAAGAAGTGTTCGCTCTCCAATGGGGCCCACTGCAGTGACGGCCCCTGCTGT
AACAACACCTCATGTCTTTTTCAGTCACGAGGGTATGAATGTCGGGATGCCGTAAACAGCTGTGATATCA
CCGAGTACTGCACTGGAGACTCTGGCCAGTGCCCACCGAACCTCCATAAACAAGATGGCTATAGCTGCAA
TCAAAATCAGGGTCGCTGCTACAATGGCGAGTGCAAGACAAGGGACAATCAATGCCAGTACATCTGGGGG
ACAAAGGCTGCGGGGTCAGACAAGTTCTGCTATGAAAAGCTGAACACGGAAGGCACCGAGAAGGGCAATT
GTGGAAAGGATGGAGACCGGTGGATCCCGTGCAGCAAGCATGATGTGTTCTGTGGATTTCTGCTTTGCAC
CAATCTTACCCGAGCTCCACGTATCGGTCAACTTCAAGGAGAGATCATCCCGACTTCCTTCTATCATCAA
GGCCGAGTGATTGACTGCAGTGGTGCTCAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 88691. Forward Primer - name:088691_F_cDNA_Adam23, sequence:GTGTGTTCTCGAATAAGAGGGG; Reverse Primer - name:088691_N_SP6_cDNA_Adam23, sequence:ATGAGCACCACTGCAGTCAAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7835 same embryo
 EMAGE:7836 same embryo
 EMAGE:7833 same embryo
 EMAGE:7834 same embryo
 EMAGE:7831 same embryo
 EurExpress:euxassay_007602 same experiment
 MGI:4822976 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS