Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7833

Adam12 a disintegrin and metallopeptidase domain 12 (meltrin alpha) ( MGI:105378)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7833 EMAGE:7833 EMAGE:7833 EMAGE:7833 EMAGE:7833
"Pseudo-wholemount" of euxassay_007599. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007599_01 euxassay_007599_02 euxassay_007599_03 euxassay_007599_04
EMAGE:7833 EMAGE:7833 EMAGE:7833 EMAGE:7833 EMAGE:7833
euxassay_007599_05 euxassay_007599_06 euxassay_007599_07 euxassay_007599_08 euxassay_007599_09
EMAGE:7833 EMAGE:7833 EMAGE:7833 EMAGE:7833 EMAGE:7833
euxassay_007599_10 euxassay_007599_11 euxassay_007599_12 euxassay_007599_13 euxassay_007599_14
EMAGE:7833 EMAGE:7833 EMAGE:7833 EMAGE:7833 EMAGE:7833
euxassay_007599_15 euxassay_007599_16 euxassay_007599_17 euxassay_007599_18 euxassay_007599_19
EMAGE:7833 EMAGE:7833 EMAGE:7833 EMAGE:7833
euxassay_007599_20 euxassay_007599_21 euxassay_007599_22 euxassay_007599_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7833Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7833_wholemount_strong.wlz
7833_wholemount_moderate.wlz
7833_wholemount_weak.wlz
7833_wholemount_possible.wlz
7833_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7833_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 16 17 18 19 20 21 22 23
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 21 moderate expression: see section 14 15 16 17 18 19 20
peritoneal component
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 21 22 23 moderate expression: see section 14 15 16 17 18 19 20
radius
strong strong
regionalstrong expression: see section 23
ulna
strong strong
regionalstrong expression: see section 23
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 22 23
humerus
strong strong
regionalstrong expression: see section 23
upper arm rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 20 21 22 23
forelimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 21 22 23
forelimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 01 21 22 23
forelimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 01 22 23
forelimb digit 5 mesenchyme
strong strong
regionalstrong expression: see section 01
hindlimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 18 19 20
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 16 18 19 20
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 16 18 19 20
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 16 18 19 20
hindlimb digit 5 mesenchyme
strong strong
regionalstrong expression: see section 16 18 19 20
fibula
strong strong
regionalstrong expression: see section 22 23
tibia
strong strong
regionalstrong expression: see section 22 23
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 21 22 23
femur
strong strong
regionalstrong expression: see section 03 19 20 21 22 23
upper leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 16 18 19 20 21 22 23
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
diencephalon meninges
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 moderate expression: see section 22 23
hindbrain meninges
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 moderate expression: see section 22
midbrain meninges
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
spinal cord meninges
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
nasal septum
moderate moderate
regionalmoderate expression: see section 11 12
viscerocranium
strong strong
regionalExpression in the turbinate bone.
stomach mesentery
strong strong
regionalstrong expression: see section 04 05 06 07 08 09
rectum mesentery
strong strong
regionalstrong expression: see section 11 12
duodenum caudal part mesentery
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19
jejunum vascular element
strong strong
regionalstrong expression: see section 18
jejunum mesentery
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15
midgut loop mesentery
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 16 17 19
rest of midgut mesentery
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19
mandible
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 12 13 14 15 16 17 18 19 20 21
maxilla
strong strong
regionalstrong expression: see section 06 07 08 09 10 13 14 15 16 17 18
urinary system
strong strong
regionalstrong expression: see section 09 10 11 12 13
bladder
strong strong
regionalstrong expression: see section 09 10 11 12 13
metanephros
moderate moderate
regionalmoderate expression: see section 07 08 09 15 16
metanephros
strong strong
regionalstrong expression: see section 18 moderate expression: see section 07 08 09 15 16 17
left lung mesenchyme
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12
right lung mesenchyme
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 20 21 22
axial skeleton
strong strong
regionalstrong expression: see section 08 10 11 14 15 16 moderate expression: see section 12 13
vault of skull
strong strong
regionalstrong expression: see section 01
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 17 18 19 20 21 22 23
clavicle
strong strong
regionalstrong expression: see section 06 07 08 14 15 16 17 18
tail mesenchyme
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35879
Entity Detected:Adam12, a disintegrin and metallopeptidase domain 12 (meltrin alpha) ( MGI:105378)
Sequence:sense strand is shown

>T35879
AGAAAGTCCAGTCGGTCAAGAGCCTTGCCAGGTGGCGTGGCTGGACGTCCTCCTTTTGTTCCTGCACTGA
GGAATAGTTATAGGTTATGTGACCCCACTTCACAGGCAAGTGGGAGGCGAACCTTGCAGGCATGCCCCTT
AAAAGCTGGTCTCAGACCTACAATAGTCCTGAGTCTGTTTTCCCAGCACACAGAGAGCAACAATGCAGTT
TTCCATTTCAAAATATGCATGCCGAGTTTGCGCTCTGTGTGAGTGTTTCCAGGTTACACATATGGGATGA
CATCACAGAAACCACACAAGCAACAAATTAAATTCTACGGGAAGAAATCCTCCTGACTGGTCTCTGAGGA
GACATTTTTATGCCTTCTTAACTTTATTAGGAACTCTCAGGCTGAAGCTAGGGGTCATTGTCCCCCAACA
AATCAATACAAAGCCATCAATGNACTCTCGAAGAACTGCCAAACCCTGATCTGTGTGAATGTTCTCAGGA
GCCTGTGATCCCCATGGTGCTANAAAGAGGCTGGAGCTGGGCCAACAAGAAGGCCTAAGAGTCCTCCTGC
CTCTCAGCAGATGTTTACTGAGCACTCTGAGCCAGAAGCACCCCGACAACCAGGAGGACGATNGCTGGGC
AGTAGGGCGCCCAGCCACTTGCAGCTCTTTCCTCTGAGGCCCGCTTTGTGTTTTAATTCCCTTCTGTCAG
GCCCCAANCAGNGGACACTGTCCTATAGACCTCCCTCTNAGTTTTCAGACGGCCTAAGCCATAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 97304. Forward Primer - name:097304_F_cDNA_Adam12, sequence:AGAAAGTCCAGTCGGTCAAGAG; Reverse Primer - name:097304_N_SP6_cDNA_Adam12, sequence:GTATGGCTTAGGCCGTCTGAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7835 same embryo
 EMAGE:7836 same embryo
 EMAGE:7834 same embryo
 EMAGE:7831 same embryo
 EMAGE:7832 same embryo
 EurExpress:euxassay_007599 same experiment
 MGI:4822973 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS