Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7835

Acvr2b activin receptor IIB ( MGI:87912)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7835 EMAGE:7835 EMAGE:7835 EMAGE:7835 EMAGE:7835
"Pseudo-wholemount" of euxassay_007595. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007595_01 euxassay_007595_02 euxassay_007595_03 euxassay_007595_04
EMAGE:7835 EMAGE:7835 EMAGE:7835 EMAGE:7835 EMAGE:7835
euxassay_007595_05 euxassay_007595_06 euxassay_007595_07 euxassay_007595_08 euxassay_007595_09
EMAGE:7835 EMAGE:7835 EMAGE:7835 EMAGE:7835 EMAGE:7835
euxassay_007595_10 euxassay_007595_11 euxassay_007595_12 euxassay_007595_13 euxassay_007595_14
EMAGE:7835 EMAGE:7835 EMAGE:7835 EMAGE:7835 EMAGE:7835
euxassay_007595_15 euxassay_007595_16 euxassay_007595_17 euxassay_007595_18 euxassay_007595_19
EMAGE:7835 EMAGE:7835 EMAGE:7835 EMAGE:7835 EMAGE:7835
euxassay_007595_20 euxassay_007595_21 euxassay_007595_22 euxassay_007595_23 euxassay_007595_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7835Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7835_wholemount_strong.wlz
7835_wholemount_moderate.wlz
7835_wholemount_weak.wlz
7835_wholemount_possible.wlz
7835_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7835_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 13 14 15 weak expression: see section 11 12
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 05 06 07 08 15 16 17 18
thyroid gland
moderate moderate
regionalmoderate expression: see section 10 14 15
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 08 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 17 18 19 20 21
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 16
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 15 16
cervical ganglion
moderate moderate
regionalmoderate expression: see section 08 09 16 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 12 13 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 14 15 16 17
inner ear
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 17 18 19 20 21 weak expression: see section 22 23
pharyngo-tympanic tube
weak weak
regionalweak expression: see section 01 02 03 22 23 24
retina
moderate moderate
regionalmoderate expression: see section 01 02 03 21 22 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 13 14 15 16 17
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 11 13
pharynx
moderate moderate
regionalmoderate expression: see section 11 13 14
esophagus epithelium
moderate moderate
regionalmoderate expression: see section 12
pharynx epithelium
moderate moderate
regionalmoderate expression: see section 12
stomach
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 02 03 04 05 06 07 08
rectum
moderate moderate
regionalmoderate expression: see section 11
midgut
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 15 16 weak expression: see section 04 05 06 07 08 12
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 13 14 15
lower jaw molar
moderate moderate
regionalmoderate expression: see section 05 06 18 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 13 14
upper jaw molar
moderate moderate
regionalmoderate expression: see section 05 06 18 19
urinary system
moderate moderate
regionalmoderate expression: see section 11
metanephros
moderate moderate
regionalmoderate expression: see section 07 08 09 10 15 16 17 18 19
left lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 weak expression: see section 12
right lung
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35877
Entity Detected:Acvr2b, activin receptor IIB ( MGI:87912)
Sequence:sense strand is shown

>T35877
ACATCCATGAGGTGAGACAGTGCCAGCGTTGGGCAGGGAGAAGGGACGGCTGTGCGGACTCCTTTAAGCC
CTTGCCTTTCCAGGACCCGGGGCCTCCGCCCCCATCCCCTCTGGTGGGCCTGAAGCCACTACAGCTGCTG
GAGATCAAGGCTCGGGGCCGCTTTGGCTGCGTTTGGAAGGCTCAGCTCATGAACGACTTTGTGGCTGTGA
AGATCTTCCCACTTCAGGACAAGCAGTCGTGGCAGAGTGAACGGGAAATCTTCAGCACACCCGGCATGAA
GCACGAAAACTTGTTGCAGTTCATTGCTGCCGAGAAACGAGGCTCCAACCTGGAGGTGGAGCTGTGGCTC
ATCACAGCCTTCCACGACAAGGGCTCCCTCACGGATTACCTCAAGGGGAACATCATCACGTGGAACGAAC
TGTGCCACGTGGCGGAGACGATGTCACGAGGCCTCTCATACCTGCATGAGGATGTGCCGTGGTGTCGTGG
TGAGGGCCACAAGCCTTCTATTGCCCACAGGGACTTCAAAAGCAAGAATGTACTGCTGAAGAGCGACCTC
AC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 97294. Forward Primer - name:097294_F_cDNA_Acvr2b, sequence:ACATCCATGAGGTGAGACAGTG; Reverse Primer - name:097294_N_SP6_cDNA_Acvr2b, sequence:GTGAGGTCGCTCTTCAGCAGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7836 same embryo
 EMAGE:7833 same embryo
 EMAGE:7834 same embryo
 EMAGE:7831 same embryo
 EMAGE:7832 same embryo
 EurExpress:euxassay_007595 same experiment
 MGI:4822965 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS