Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7946

Slc8a1 solute carrier family 8 (sodium/calcium exchanger), member 1 ( MGI:107956)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7946 EMAGE:7946 EMAGE:7946 EMAGE:7946 EMAGE:7946
"Pseudo-wholemount" of euxassay_013100. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013100_01 euxassay_013100_02 euxassay_013100_03 euxassay_013100_04
EMAGE:7946 EMAGE:7946 EMAGE:7946 EMAGE:7946 EMAGE:7946
euxassay_013100_05 euxassay_013100_06 euxassay_013100_07 euxassay_013100_08 euxassay_013100_09
EMAGE:7946 EMAGE:7946 EMAGE:7946 EMAGE:7946 EMAGE:7946
euxassay_013100_10 euxassay_013100_11 euxassay_013100_12 euxassay_013100_13 euxassay_013100_14
EMAGE:7946 EMAGE:7946 EMAGE:7946 EMAGE:7946 EMAGE:7946
euxassay_013100_15 euxassay_013100_16 euxassay_013100_17 euxassay_013100_18 euxassay_013100_19
EMAGE:7946 EMAGE:7946 EMAGE:7946 EMAGE:7946
euxassay_013100_20 euxassay_013100_21 euxassay_013100_22 euxassay_013100_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7946Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7946_wholemount_strong.wlz
7946_wholemount_moderate.wlz
7946_wholemount_weak.wlz
7946_wholemount_possible.wlz
7946_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7946_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
telencephalon marginal layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
pons mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 02 03 05 weak expression: see section 04 18 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 15 17 weak expression: see section 04
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 05 06 07 15 17 weak expression: see section 04 16 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 05 06
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 15 17 weak expression: see section 04
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 15
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 weak expression: see section 04 12 13 14
neural retina
weak weak
regionalweak expression: see section 01 02 03 21 22 23
heart atrium
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15
heart ventricle
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39362
Entity Detected:Slc8a1, solute carrier family 8 (sodium/calcium exchanger), member 1 ( MGI:107956)
Sequence:sense strand is shown

>T39362
CATCCTTGTGCCTAAAACCTTCTTTACAAAAGAAATGAGCACAACACACACACACACACACACACACACA
CACACACACACACACACACCCAACCCCTTGGCTTCGCAGGGGGTAAAAAGTAAAGAACAGAACTTGTACA
GGAGTTGTGGTCAGAGTGTAAGGGATCTATCACGAGGGAGCTTCAAAGACAAAGAGGTGGGAAAGACAGA
CGAAATTGGACACGATCATAGTACAGGTGATATAAGCAGGTCCTCAGTCCTCCAGGTCAGGCTGGAGAGC
TGCTCGTGTGTGTAAGACTGTATGGTTCAATAACGTCATCATACGTTGGAATGCCTTGAGCAGTAGTTTG
GTCATGATGTACATGGAAGATTAACTGAGTCTTTCAGTTTGGAATCTCTCAGGCCAACCGACATAATCTA
TGGGTATTTTCAGTGTGAAACACATGCAAACATGGTGCATGGACTATGTTTGTGATTCTGTGGAGAAACG
AAATGTTTAACAATCACAGACTTTGCGGTGTTTCCGAGTTTTGCAGGAAGCAAAAGTCAGCATGGCCATG
ATGGCTAACGGTACTAGAGTTACAATCATCAGAAGTGCTGTTGGAAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 70962. Forward Primer - name:070962_F_cDNA_AV344025, sequence:CATCCTTGTGCCTAAAACCTTC; Reverse Primer - name:070962_N_SP6_cDNA_AV344025, sequence:GTTCCAACAGCACTTCTGATGAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7949 same embryo
 EMAGE:7947 same embryo
 EMAGE:7948 same embryo
 EMAGE:7944 same embryo
 EMAGE:7945 same embryo
 EurExpress:euxassay_013100 same experiment
 MGI:4828284 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS