Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8058

Shisa3 shisa homolog 3 (Xenopus laevis) ( MGI:3041225)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8058 EMAGE:8058 EMAGE:8058 EMAGE:8058 EMAGE:8058
"Pseudo-wholemount" of euxassay_016050. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016050_01 euxassay_016050_02 euxassay_016050_03 euxassay_016050_04
EMAGE:8058 EMAGE:8058 EMAGE:8058 EMAGE:8058 EMAGE:8058
euxassay_016050_05 euxassay_016050_06 euxassay_016050_07 euxassay_016050_08 euxassay_016050_09
EMAGE:8058 EMAGE:8058 EMAGE:8058 EMAGE:8058 EMAGE:8058
euxassay_016050_10 euxassay_016050_11 euxassay_016050_12 euxassay_016050_13 euxassay_016050_14
EMAGE:8058 EMAGE:8058 EMAGE:8058 EMAGE:8058 EMAGE:8058
euxassay_016050_15 euxassay_016050_16 euxassay_016050_17 euxassay_016050_18 euxassay_016050_19
EMAGE:8058 EMAGE:8058 EMAGE:8058 EMAGE:8058 EMAGE:8058
euxassay_016050_20 euxassay_016050_21 euxassay_016050_22 euxassay_016050_23 euxassay_016050_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8058Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8058_wholemount_strong.wlz
8058_wholemount_moderate.wlz
8058_wholemount_weak.wlz
8058_wholemount_possible.wlz
8058_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8058_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 09 10 11 15 16 17 18 moderate expression: see section 12 14
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 13
midbrain mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 15 16 17 18 19 20 moderate expression: see section 12 14
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 18 19 20 weak expression: see section 17 21 22
stomach
strong strong
regionalstrong expression: see section 07 moderate expression: see section 08 weak expression: see section 03 04 05 06
midgut
weak weak
regionalweak expression: see section 09 10 11 13 17
metanephros
strong strong
regionalstrong expression: see section 08 09 10 12 16 17 18 19 20
axial skeleton
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 14 15 16
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 10 11 14 15 17
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 09 10 11 14 15 17
tail mesenchyme
weak weak
regionalweak expression: see section 10 11 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39775
Entity Detected:Shisa3, shisa homolog 3 (Xenopus laevis) ( MGI:3041225)
Sequence:sense strand is shown

>T39775
TCTGGTGACGACACATAAGGACCAGGCTAGAAAATAAATAAATAAATTTATCCAGTTTCCTGAACTCTAT
TTGGGGTTTTCAAATCAGGATTCTTGATTTGAAATTCATCCAGTCATCTATCACCTTCAGTATCCCTGTA
CCAAGTCAACAGAGGTAGAGGAGGGTTAATTGGCTCCCTTGTTTTCCAGTTGAGGGTCAGAGAAAACCAG
TTCGAAGGCATTGCTCCTTAGCCAGGAAGTTAGAGTGGTGCCAACTTCCAGTCGCTTCTCTCTTCCACAT
GCAAATCTGGTCTTTCTTCCAAGTATTCAAGATTATATAAAAATCAACTTAAGAGATAATTGGATGTAAA
GAACAAATGTCTGAGACTGTGCTCAAACCCACACAACGGGATCACCATCCTGGTTGTAGTAGCTCTTCTG
TCCTGTTTCGTTGACAGTTTTAAGTTAACTTCCGCTGAGTTCTCTGTTCTAACACAAGTCAAGTGCAGTG
CTGAGCAGTTGTGTGTTAACTTATCCAATCCTCCAAACAACTCAGAGGTATTGTAACTACCATCTTACAA
AATTGGAAACGGAGGAAAAGACTAAAGTGTTCAACTTTCTACAGCAAGTTAATACTGGAGTCGGTGTGTA
GAGAATGCCTCAAACACCAGATTGGCACCTGCTTTAAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 87246. Forward Primer - name:087246_F_cDNA_D830007B15Rik, sequence:TCTGGTGACGACACATAAGGAC; Reverse Primer - name:087246_N_SP6_cDNA_D830007B15Rik, sequence:TTTAAAGCAGGTGCCAATCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8060 same embryo
 EMAGE:8063 same embryo
 EMAGE:8062 same embryo
 EMAGE:8059 same embryo
 EMAGE:8061 same embryo
 EurExpress:euxassay_016050 same experiment
 MGI:4828057 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS