Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8076

Il1rapl1 interleukin 1 receptor accessory protein-like 1 ( MGI:2687319)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8076 EMAGE:8076 EMAGE:8076 EMAGE:8076 EMAGE:8076
"Pseudo-wholemount" of euxassay_016091. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016091_01 euxassay_016091_02 euxassay_016091_03 euxassay_016091_04
EMAGE:8076 EMAGE:8076 EMAGE:8076 EMAGE:8076 EMAGE:8076
euxassay_016091_05 euxassay_016091_06 euxassay_016091_07 euxassay_016091_08 euxassay_016091_09
EMAGE:8076 EMAGE:8076 EMAGE:8076 EMAGE:8076 EMAGE:8076
euxassay_016091_10 euxassay_016091_11 euxassay_016091_12 euxassay_016091_13 euxassay_016091_14
EMAGE:8076 EMAGE:8076 EMAGE:8076 EMAGE:8076 EMAGE:8076
euxassay_016091_15 euxassay_016091_16 euxassay_016091_17 euxassay_016091_18 euxassay_016091_19
EMAGE:8076 EMAGE:8076 EMAGE:8076 EMAGE:8076 EMAGE:8076
euxassay_016091_20 euxassay_016091_21 euxassay_016091_22 euxassay_016091_23 euxassay_016091_24
EMAGE:8076 EMAGE:8076 EMAGE:8076
euxassay_016091_25 euxassay_016091_26 euxassay_016091_27

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8076Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8076_wholemount_strong.wlz
8076_wholemount_moderate.wlz
8076_wholemount_weak.wlz
8076_wholemount_possible.wlz
8076_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8076_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 17 18 19 weak expression: see section 05 06 07 12 14 15 16 20 21 22 23 24 25
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 05 06 07 08 09 10 11 18 19 20 22 23 24 weak expression: see section 03 12 13 14 15 16 21 25
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 17 18 weak expression: see section 15 16
medulla oblongata alar plate mantle layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 15 16 17 18 19
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 11 14 15
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 22 weak expression: see section 05 06 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pons mantle layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 21 22 weak expression: see section 06
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 08 09 19 20
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 21 22 23 weak expression: see section 05 06 07 08 09 18 19 20
trigeminal v nerve
weak weak
regionalweak expression: see section 18
ventral grey horn
weak weak
regionalweak expression: see section 11 12 13 14 15 16 17
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 09 11 18 19
extrinsic ocular muscle
weak weak
regionalweak expression: see section 05 06 21 22
neural retina
weak weak
regionalweak expression: see section 02 24 25 26
lung
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 16 17 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39792
Entity Detected:Il1rapl1, interleukin 1 receptor accessory protein-like 1 ( MGI:2687319)
Sequence:sense strand is shown

>T39792
CACTTATCGTCCGATTTCCTTCCTTCTTTAAAAAATAACCAAAACAAAACAAAACACATTTAAAAAATTT
CTCCCTCTTTTTCTGATCTCTCCTTCTTCAGTCTCTCCCTCTCTCTCTCTCTTTTTATTCTGCCTCTTCT
TTTTTTTTTCTTCCTAGTCCTTTTTTTTCCCCTTTCCTGCTCTGCACCTGGATTGTATCGTCACTAAACA
ATCGGGCACTTTGAGAACTAACTGGCGACAGTCTTGTAGGGAAGATCTGTATGGAATTATCTGCTTTTAT
GGTGAACTTGGCATTTGTGAATGGGTACCTTGTTCACAATATTAATTGCTAGCAAAAACAAGAAAAAGAA
CACAGGAGTAAAACGTGGATTTTTCTGAATACGCATTGTGATGACCAGCAATTACCTTACCGGCTGATAT
CCAGAGGAGAATAATTTGGAAGACAGTTGTGGGAACAGCCTGTAAGAACTGGAAGATGAAAGCTCCGATC
CCACATTTGATTCTCTTATATGCTACTTTCACTCAGAGTCTGAAGGTTGTGACTAAAAGAGGTTCTGCTG
ATGGATGCACAGATTGGTCTGTTGATATCAAGAAGTACCAAGTTTTGGTGGGAGAACCTGTTAGAATCAA
GTGTGCACTCTTTTATGGTTATATAAGAACAAACTACTCGCTCGCCCAAAGTGCTGGACTCAGCTTAATG
TGGTATAAAAGCTCTGGTCCAGGAGATTTTGAAGAGCCTATCGCCTTTGATGGAAGTAGAATGAGCAAAG
AGGAAGATTCCATTTGGTTCAGACCAACATTACTACAGGACAGTGGGCTTTATGCCTGTGTCATCAGGAA
TTCCACATAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 86616. Forward Primer - name:086616_F_cDNA_Il1rapl1, sequence:CACTTATCGTCCGATTTCCTTC; Reverse Primer - name:086616_N_SP6_cDNA_Il1rapl1, sequence:GTATGTGGAATTCCTGATGACAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8078 same embryo
 EMAGE:8081 same embryo
 EMAGE:8077 same embryo
 EMAGE:8079 same embryo
 EMAGE:8080 same embryo
 EurExpress:euxassay_016091 same experiment
 MGI:4825575 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS