Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:825

Otx2 orthodenticle homolog 2 (Drosophila) ( MGI:97451)
TS15 (10.0 dpc)
in situ hybridisation

Data Images
EMAGE:825 EMAGE:825
Fig 1F Martinez-Morales et al 2001 [PMID:11493524] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd who owns the copyright. Fig 1C Martinez-Morales et al 2001 [PMID:11493524] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd who owns the copyright.

Expression pattern clarity: two stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Both images show a TS15 optic vesicle however the specimen in F is described by the authors as 10.0dpc and that in C as 9.5dpc. Only the data from Image F has been spatially mapped in this EMAGE entry. Image annotations: ov - otic vesicle.
Expression Pattern Description
Spatial Annotation:
EMAGE:825EMAGE:825Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
825_voxel_strong_3D_1.wlz
825_voxel_moderate_3D_1.wlz
825_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:825_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
optic vesicle
detected detected
regionalExpression is predominant in the dorsal part.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1331375
Entity Detected:Otx2, orthodenticle homolog 2 (Drosophila) ( MGI:97451)
Sequence:sense strand is shown

>MGI:1331375
GCCAGTTCAGTCCCCCCTCTAGTACCTCAGTCCCAACCATTGCCAGCAGCAGTGCTCCAGTGTCTATCTG
GAGCCCAGCGTCCATCTCCCCACTGTCTGACCCCTTGTCCACTTCCTCCTCCTGCATGCAGAGGTCCTAT
CCCATGACCTATACTCAGGCTTCAGGTTATAGTCAAGGCTATGCTGGCTCAACTTCCTACTTTGGGGGCA
TGGACTGTGGATCTTATTTGACCCCTATGCATCACCAGCTTCCTGGACCAGGGG
nt 718 - nt 981 of NM_144841.1
Notes:The probe used in this study by Martinez-Morales et al 2001 [PMID:11493524] is indicated as that used by Acampora et al, 1997 [PMID:9342056] which was originally described by Simeone et al., 1993 [PMID:8101484] as "a 263 nucleotide HaeIII fragment" (see Figure 1a therein).
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Age:10.0 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:section
Procedures
Staining procedure:autoradiography
General Information
Authors:Martinez-Morales et al 2001 [PMID:11493524] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:11493524] Martinez-Morales JR, Signore M, Acampora D, Simeone A, Bovolenta P 2001 Otx genes are required for tissue specification in the developing eye. Development (128):2019-30
 [ PMID:9342056] Acampora D, Avantaggiato V, Tuorto F, Simeone A 1997 Genetic control of brain morphogenesis through Otx gene dosage requirement. Development (124):3639-50
 [ PMID:8101484] Simeone A, Acampora D, Mallamaci A, Stornaiuolo A, D'Apice MR, Nigro V, Boncinelli E 1993 A vertebrate gene related to orthodenticle contains a homeodomain of the bicoid class and demarcates anterior neuroectoderm in the gastrulating mouse embryo. EMBO J (12):2735-47
Links:MGI:2137339 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI