Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8258

Zc3h7a zinc finger CCCH type containing 7 A ( MGI:2445044)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8258 EMAGE:8258 EMAGE:8258 EMAGE:8258 EMAGE:8258
"Pseudo-wholemount" of euxassay_007309. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007309_01 euxassay_007309_02 euxassay_007309_03 euxassay_007309_04
EMAGE:8258 EMAGE:8258 EMAGE:8258 EMAGE:8258 EMAGE:8258
euxassay_007309_05 euxassay_007309_06 euxassay_007309_07 euxassay_007309_08 euxassay_007309_09
EMAGE:8258 EMAGE:8258 EMAGE:8258 EMAGE:8258 EMAGE:8258
euxassay_007309_10 euxassay_007309_11 euxassay_007309_12 euxassay_007309_13 euxassay_007309_14
EMAGE:8258 EMAGE:8258 EMAGE:8258 EMAGE:8258 EMAGE:8258
euxassay_007309_15 euxassay_007309_16 euxassay_007309_17 euxassay_007309_18 euxassay_007309_19
EMAGE:8258 EMAGE:8258 EMAGE:8258 EMAGE:8258
euxassay_007309_20 euxassay_007309_21 euxassay_007309_22 euxassay_007309_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8258Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8258_wholemount_strong.wlz
8258_wholemount_moderate.wlz
8258_wholemount_weak.wlz
8258_wholemount_possible.wlz
8258_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8258_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 03
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 03
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 02
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 02 03
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 02
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 02 03
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 03
femur
moderate moderate
regionalmoderate expression: see section 02 03 17 22 weak expression: see section 19
mesenchyme
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
mandible
moderate moderate
regionalmoderate expression: see section 08 09
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 04 06 07 08 09 11 12 13 14 16 17 18 19
axial skeleton
moderate moderate
regionalmoderate expression: see section 08 09 10 12 13 14 15 weak expression: see section 06 07
basioccipital bone
moderate moderate
regionalmoderate expression: see section 04 05 06
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 12 13 14
exoccipital bone
moderate moderate
regionalmoderate expression: see section 03 04 05 06
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 15 16 17 18 19 20 23 weak expression: see section 21 22
vault of skull
moderate moderate
regionalmoderate expression: see section 01 02 03
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 19 23 weak expression: see section 21 22
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 13
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 09
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1868
Entity Detected:Zc3h7a, zinc finger CCCH type containing 7 A ( MGI:2445044)
Sequence:sense strand is shown

>T1868
TGGCCTCGAGGCCAGATTCGGCACGAGGACAATAAGTGCCTTGTCCACATTTTGAGAGAGACCACAGTAA
AATATTCCAAAATACGTTCTTTTCATAAACAATGTCAATTTGATATTTGTCGACATGAAGTTCGTTATGG
CTGCGTGAGGGAAGATGAGTGCTTCTATGCCCATAGTCTTATTGAACTGAAAGTCTGGATAATGCAAAGT
GAAAGAGGTATCTCCCATGATGATATTGCTCAACAATCCAAACAATATTGGAGAAGTTTGCAAGCAAGCA
TGCCGGGAGTGCAGGTCCTTGGTAATCAAATAATGCCTGGATTACTTAACATGGAGATAAAGTTTGTATG
TGCTCAGTGTCTGAGAAATGGCCAAGTCATTGAACCAGACAGGAACAGAAAGTACTGCAGTGCCAAAGCA
CAGCATTCGTGGACCAAAGAACGTCGTGCAATGAGAGCGATGTCTTTTGAACGTAAGAAGTGGATGAACA
TCCGTCCTCTCCCCACAAAGAAACAAATGCCTTTACAGTTTGATCTATGCAACCATATT
Notes:The probe template was PCR amplified from IMAGE:596354 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:596354 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8260 same embryo
 EMAGE:8259 same embryo
 EurExpress:euxassay_007309 same experiment
 MGI:4829267 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS