Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8275

Adrbk2 adrenergic receptor kinase, beta 2 ( MGI:87941)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8275 EMAGE:8275 EMAGE:8275 EMAGE:8275 EMAGE:8275
"Pseudo-wholemount" of euxassay_007610. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007610_01 euxassay_007610_02 euxassay_007610_03 euxassay_007610_04
EMAGE:8275 EMAGE:8275 EMAGE:8275 EMAGE:8275 EMAGE:8275
euxassay_007610_05 euxassay_007610_06 euxassay_007610_07 euxassay_007610_08 euxassay_007610_09
EMAGE:8275 EMAGE:8275 EMAGE:8275 EMAGE:8275 EMAGE:8275
euxassay_007610_10 euxassay_007610_11 euxassay_007610_12 euxassay_007610_13 euxassay_007610_14
EMAGE:8275 EMAGE:8275 EMAGE:8275 EMAGE:8275 EMAGE:8275
euxassay_007610_15 euxassay_007610_16 euxassay_007610_17 euxassay_007610_18 euxassay_007610_19
EMAGE:8275 EMAGE:8275 EMAGE:8275 EMAGE:8275 EMAGE:8275
euxassay_007610_20 euxassay_007610_21 euxassay_007610_22 euxassay_007610_23 euxassay_007610_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8275Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8275_wholemount_strong.wlz
8275_wholemount_moderate.wlz
8275_wholemount_weak.wlz
8275_wholemount_possible.wlz
8275_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8275_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
adrenal gland
weak weak
regionalweak expression: see section 07 08 15 16
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 11 13 14 weak expression: see section 12
submandibular gland primordium
weak weak
regionalweak expression: see section 07 08 09 16 17 18
thyroid gland
moderate moderate
regionalmoderate expression: see section 10 14
pituitary gland
weak weak
regionalweak expression: see section 10 11 12 13 14 15
vibrissa
weak weak
regionalweak expression: see section 04 05 06 08 20 21
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 15 16
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 18 weak expression: see section 08 17
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 06 07
trigeminal v nerve
strong strong
regionalstrong expression: see section 09 16
ventral grey horn
moderate moderate
single cellmoderate expression: see section 09 10 11 12 13
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 09 15
cervical ganglion
weak weak
regionalweak expression: see section 08 16
thoracic ganglion
weak weak
regionalweak expression: see section 11 12
dorsal root ganglion
weak weak
regionalweak expression: see section 06 07 08 09 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35892
Entity Detected:Adrbk2, adrenergic receptor kinase, beta 2 ( MGI:87941)
Sequence:sense strand is shown

>T35892
ATCATGCTGTCTCTCGTTAGCACTGGGGATTGTCCCTTTATTGTCTGCATGACCTACGCCTTCCACACGC
CGGACAAACTCTGCTTCATCCTGGACCTGATGAACGGGGGCGACATGCACTACCATCTCTCTCAACACGG
GGTGTTTTCTGAGAAGGAGATGCGGTTTTATGCCAGCGAGATCATCCTGGGCCTCGAGCACATGCACACC
TGCTTCGTAGTCTACAGAGACCTGAAGCCTGCGAACATCCTCCTAGATGAATATGGGCACGTGAGGATAT
CGGATCTCGGCCTTGCCTGCGATTTCTCCAAAAAGAAGCCTCATGCCAGCGTGGGCACCCATGGGTACAT
GGCTCCCGAGGTGTTGCAGAAGGGAACGTGCTATGACAGCAGCGCCGACTGGTTCTCCCTGGGCTGTATG
CTCTTCAAGCTTCTGCGGGGCCACAGCCCCTTCAGGCAGCATAAAACCAAAGACAAGCATGAGATAGACC
GAATGACCCTGACCGTGAACGTGCAGCTTCCAGATGCCTTCTCCCCTGAGCTGAGGTCCCTCTTAGAGGG
TTTGCTCCAGCGGGACGTGAGCCAGCGGCTGGGCTGCGGAGGAGGAGGGGCACGAGAGTTGAAGGAGCAC
ATCTTCTTCAAGGGCATTGACTGGCAGCATGTGTACTTACGGAAGTACCCGCCACCCCTAATCCCTCCTC
GGGGAGAGGTCAACGCTGCAGATGCCTTCGATATCGGCTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 93764. Forward Primer - name:093764_F_cDNA_Adrbk2, sequence:ATCATGCTGTCTCTCGTTAGCA; Reverse Primer - name:093764_N_SP6_cDNA_Adrbk2, sequence:GAGCCGATATCGAAGGCATCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8276 same embryo
 EMAGE:8274 same embryo
 EurExpress:euxassay_007610 same experiment
 MGI:4823016 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS