Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8292

Pam peptidylglycine alpha-amidating monooxygenase ( MGI:97475)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8292 EMAGE:8292 EMAGE:8292 EMAGE:8292 EMAGE:8292
"Pseudo-wholemount" of euxassay_007685. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007685_01 euxassay_007685_02 euxassay_007685_03 euxassay_007685_04
EMAGE:8292 EMAGE:8292 EMAGE:8292 EMAGE:8292 EMAGE:8292
euxassay_007685_05 euxassay_007685_06 euxassay_007685_07 euxassay_007685_08 euxassay_007685_09
EMAGE:8292 EMAGE:8292 EMAGE:8292 EMAGE:8292 EMAGE:8292
euxassay_007685_10 euxassay_007685_11 euxassay_007685_12 euxassay_007685_13 euxassay_007685_14
EMAGE:8292 EMAGE:8292 EMAGE:8292 EMAGE:8292 EMAGE:8292
euxassay_007685_15 euxassay_007685_16 euxassay_007685_17 euxassay_007685_18 euxassay_007685_19
EMAGE:8292 EMAGE:8292 EMAGE:8292 EMAGE:8292 EMAGE:8292
euxassay_007685_20 euxassay_007685_21 euxassay_007685_22 euxassay_007685_23 euxassay_007685_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8292Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8292_wholemount_strong.wlz
8292_wholemount_moderate.wlz
8292_wholemount_weak.wlz
8292_wholemount_possible.wlz
8292_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8292_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
interdigital region between forelimb digits 1 and 2
moderate moderate
regionalmoderate expression: see section 05 21 22
interdigital region between forelimb digits 2 and 3
moderate moderate
regionalmoderate expression: see section 05 21
interdigital region between hindlimb digits 1 and 2
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 08
interdigital region between hindlimb digits 2 and 3
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 08
interdigital region between hindlimb digits 4 and 5
weak weak
regionalweak expression: see section 08 09
adrenal medulla
moderate moderate
regionalmoderate expression: see section 10 16 weak expression: see section 08 09
pancreas
strong strong
regionalstrong expression: see section 10 moderate expression: see section 09
thyroid gland
moderate moderate
regionalmoderate expression: see section 10 14
vibrissa
strong strong
regionalstrong expression: see section 05 06 20 21 moderate expression: see section 19
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 weak expression: see section 10 15 16
telencephalon mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 19 20 21 22 23 24
pons mantle layer
strong strong
regionalstrong expression: see section 19
pons ventricular layer
strong strong
regionalstrong expression: see section 05 06 18 19 moderate expression: see section 07 08 09 10 11 12 13 14 weak expression: see section 15 17
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 18 19 weak expression: see section 17
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 16
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09
spinal cord floor plate
moderate moderate
regionalmoderate expression: see section 12 13
dorsal grey horn
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 09 15 16 17 weak expression: see section 08
inner ear
moderate moderate
regionalmoderate expression: see section 05 06 07 08 16 17 18 19
extrinsic ocular muscle
moderate moderate
regionalmoderate expression: see section 03 04 21 22 23
eyelid
weak weak
regionalweak expression: see section 01 02 24
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 22 23 24
heart atrium
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 15 16 17 18 19 20 21 22 moderate expression: see section 10 11 12 13 14
heart ventricle
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 07 08 09 10 11 12 13 14 15
esophagus
strong strong
regionalstrong expression: see section 11 12
tongue muscle
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
stomach
moderate moderate
regionalmoderate expression: see section 03 05 06 07 08 09 weak expression: see section 04
hindgut
strong strong
regionalstrong expression: see section 14 15
midgut
strong strong
regionalstrong expression: see section 12 13 14 15 16 moderate expression: see section 07 08 09 10 11 17 18 19
lower lip
strong strong
regionalstrong expression: see section 05 06 09 10 15 16 19 20
mandible
moderate moderate
regionalmoderate expression: see section 23 weak expression: see section 05 06 18 19 20 21 22
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 15 16 weak expression: see section 10
lower jaw molar
weak weak
regionalweak expression: see section 06 07 18 19
upper lip
strong strong
regionalstrong expression: see section 07 08 09 10 13 15 16 17 18
maxilla
weak weak
regionalweak expression: see section 05
palatal shelf
strong strong
regionalstrong expression: see section 09 10 14 15 16
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 15 16 weak expression: see section 10
upper jaw molar
weak weak
regionalweak expression: see section 06 07 18 19
trachea
weak weak
regionalweak expression: see section 12
axial skeleton
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36741
Entity Detected:Pam, peptidylglycine alpha-amidating monooxygenase ( MGI:97475)
Sequence:sense strand is shown

>T36741
CTCTTAGTTCTGGGAAGGAGCATGCAACCTGGCAGCGACCAAAATCATTTCTGCCAGCCCACTGATGTGG
CGGTGGAGCCCAGTACTGGAGCTGTCTTCGTGTCAGATGGTTACTGCAACAGTCGGATCGTGCAGTTCTC
ACCAAGCGGGAAGTTCATCACTCAGTGGGGAGAAGAGTCTTCTGGGAGCAGTCCTAAGCCAGGGCAGTTC
AGTGTTCCTCACAGTTTGGCCCTTGTGCCTCACCTGAACCAGTTGTGTGTGGCCGATAGGGAAAATGGCC
GGATCCAGTGTTTCAAGACTGACACCAAAGAATTTGTGAGAGAGATTAAGCATGCGTCATTTGGAAGGAA
TGTCTTTGCAATCTCATATATACCAGGTTTCCTCTTTGCAGTAAATGGGAAGCCTTACTTTGGAGACCAA
GAACCCGTGCAAGGATTTGTGATGAACTTTTCCAGTGGGGAAATTATAGATGTTTTCAAACCAGTTCGCA
AGCACTTTGACATGCCTCATGATATTGTGGCTTCTGAAGATGGGACTGTGTACATTGGCGACGCACACAC
AAACACCGTGTGGAAGTTCACCCTCACTGAAAGCAGGCTGGAAGTGGAGCATCGATCAGTTAAAAAGGCT
GGCATTGAGGTACCGGAAATCAAAGAAGCCGAGGCAGTTGTTGAACCCAAAGTGAAGAACAAACCCACCT
CCTCAGAATTGCAGAAGATGCAGGAGAAAAAGAAACTGATCAAAGATCCAGGCTCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74687. Forward Primer - name:074687_F_cDNA_Pam, sequence:CTCTTAGTTCTGGGAAGGAGCA; Reverse Primer - name:074687_N_SP6_cDNA_Pam, sequence:CGAGCCTGGATCTTTGATCAGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8291 same embryo
 EMAGE:8293 same embryo
 EurExpress:euxassay_007685 same experiment
 MGI:4827034 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS