Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8294

Parvb parvin, beta ( MGI:2153063)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8294 EMAGE:8294 EMAGE:8294 EMAGE:8294 EMAGE:8294
"Pseudo-wholemount" of euxassay_007690. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007690_01 euxassay_007690_02 euxassay_007690_03 euxassay_007690_04
EMAGE:8294 EMAGE:8294 EMAGE:8294 EMAGE:8294 EMAGE:8294
euxassay_007690_05 euxassay_007690_06 euxassay_007690_07 euxassay_007690_08 euxassay_007690_09
EMAGE:8294 EMAGE:8294 EMAGE:8294 EMAGE:8294 EMAGE:8294
euxassay_007690_10 euxassay_007690_11 euxassay_007690_12 euxassay_007690_13 euxassay_007690_14
EMAGE:8294 EMAGE:8294 EMAGE:8294 EMAGE:8294 EMAGE:8294
euxassay_007690_15 euxassay_007690_16 euxassay_007690_17 euxassay_007690_18 euxassay_007690_19
EMAGE:8294 EMAGE:8294 EMAGE:8294 EMAGE:8294 EMAGE:8294
euxassay_007690_20 euxassay_007690_21 euxassay_007690_22 euxassay_007690_23 euxassay_007690_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8294Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8294_wholemount_strong.wlz
8294_wholemount_moderate.wlz
8294_wholemount_weak.wlz
8294_wholemount_possible.wlz
8294_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8294_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 11 12 13 14 15
pituitary gland
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 13 14 weak expression: see section 09 15 16
diencephalon roof plate
strong strong
regionalstrong expression: see section 11 13
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 10 16 17
rest of cerebellum mantle layer
strong strong
spottedstrong expression: see section 07 08 16 17 18
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 17
midbrain mantle layer
strong strong
spottedstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
facial vii ganglion
strong strong
regionalstrong expression: see section 04 21 22
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 18 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 18 19 20 moderate expression: see section 08
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 12 13 14 15 16 17 18 19
neural retina
strong strong
regionalstrong expression: see section 02 03 23 24 moderate expression: see section 01 04
mandible
weak weak
regionalweak expression: see section 05 06 07 08 09 10 18 19 20 21 22
lower jaw incisor
weak weak
regionalweak expression: see section 11 12 13 16 17
lower jaw molar
weak weak
regionalweak expression: see section 07 08 18 19 20
maxilla
weak weak
regionalweak expression: see section 06 07 08 09 10 18 19 21 22
palatal shelf
weak weak
regionalweak expression: see section 09
upper jaw incisor
weak weak
regionalweak expression: see section 11 12 16 17
upper jaw molar
weak weak
regionalweak expression: see section 07 08 18 19 20
liver left lobe
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12
liver right lobe
strong strong
spottedstrong expression: see section 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36746
Entity Detected:Parvb, parvin, beta ( MGI:2153063)
Sequence:sense strand is shown

>T36746
GAAGACACCCAGCTAGAGGAGAATGAGGAGCGTACCATGATCGATCCCACCTCTAGAGAAGACCCCAAGT
TCAAGGAGTTGGTCAAGGTGCTTCTGGACTGGATCAACGATGTGCTGGCGGAGGAGCGCATCATTGTGAA
GCAGCTGGAGGAGGACCTGTACGATGGCCAGGTGCTCCAGAAACTTCTGGAAAAGCTGGCGCACTGCAAG
CTGAATGTGGCAGAGGTGACGCAGTCCGAGATCGGGCAGAAGCAGAAGTTGCAGACGGTTCTGGAAGCCG
TGCAAGACCTGCTTCGGCCCCATGGCTGGCCGCTGCGTTGGAATGTGGACTCTATCCATGGGAAGAACCT
AGTGGCCATTCTGCATCTCCTCGTCTCCCTGGCCATGCACTTCAGGGCCCCCATTCACCTTCCCGAGCAT
GTCACCGTGCAGGTGGTGGTCGTTCGGAAGCGAGAAGGCTTGCTGCACTCCAGCCACATCTCAGAGGAGC
TGACCACGACCACAGAGATCATGATGGGCCGGTTTGAGCGGGACGCCTTCGATACTCTTTTCGACCACGC
CCCGGACAAGCTCAACCTTGTGAAGAAGTCTCTCATCACGTTTGTGAACAAACACCTGAATAAGCTAAAC
TTGGAGGTGACTGACCTGGAGACCCAGTTTGCAGATGGTGTGTACCTAGTTCTACTTCTGGGCCTTCTTG
AAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 92289. Forward Primer - name:092289_F_cDNA_Parvb, sequence:GAAGACACCCAGCTAGAGGAGA; Reverse Primer - name:092289_N_SP6_cDNA_Parvb, sequence:CTTCAAGAAGGCCCAGAAGTAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8295 same embryo
 EMAGE:8296 same embryo
 EMAGE:8299 same embryo
 EMAGE:8298 same embryo
 EMAGE:8297 same embryo
 EurExpress:euxassay_007690 same experiment
 MGI:4827056 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS