Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8302

Igdcc4 immunoglobulin superfamily, DCC subclass, member 4 ( MGI:1858497)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8302 EMAGE:8302 EMAGE:8302 EMAGE:8302 EMAGE:8302
"Pseudo-wholemount" of euxassay_007736. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007736_01 euxassay_007736_02 euxassay_007736_03 euxassay_007736_04
EMAGE:8302 EMAGE:8302 EMAGE:8302 EMAGE:8302 EMAGE:8302
euxassay_007736_05 euxassay_007736_06 euxassay_007736_07 euxassay_007736_08 euxassay_007736_09
EMAGE:8302 EMAGE:8302 EMAGE:8302 EMAGE:8302 EMAGE:8302
euxassay_007736_10 euxassay_007736_11 euxassay_007736_12 euxassay_007736_13 euxassay_007736_14
EMAGE:8302 EMAGE:8302 EMAGE:8302 EMAGE:8302 EMAGE:8302
euxassay_007736_15 euxassay_007736_16 euxassay_007736_17 euxassay_007736_18 euxassay_007736_19
EMAGE:8302 EMAGE:8302 EMAGE:8302 EMAGE:8302
euxassay_007736_20 euxassay_007736_21 euxassay_007736_22 euxassay_007736_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8302Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8302_wholemount_strong.wlz
8302_wholemount_moderate.wlz
8302_wholemount_weak.wlz
8302_wholemount_possible.wlz
8302_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8302_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 21 22 23
upper leg muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01
hand
strong strong
regionalstrong expression: see section 01 02 03
foot
strong strong
regionalstrong expression: see section 06 07 08 09 10 11
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
visceral organ system
strong strong
regionalstrong expression: see section 18
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 15
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
pons mantle layer
strong strong
regionalstrong expression: see section 07 08 09 17 18
pons ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 16 17 18
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16
spinal cord mantle layer
strong strong
regionalstrong expression: see section 08 10 11 12 15
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15
esophagus
strong strong
regionalstrong expression: see section 12 13 14
tongue
strong strong
regionalstrong expression: see section 08
tongue muscle
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17
tail mesenchyme
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36693
Entity Detected:Igdcc4, immunoglobulin superfamily, DCC subclass, member 4 ( MGI:1858497)
Sequence:sense strand is shown

>T36693
CCTCTCCTTTGAGCATCTCTGTACCTAATTTTGTAATCTGGGAAGTGCCTGGTTTGGGAAATCTTCTTTC
GCACCCTGTCCCTCTCTGCCCCTTCCTTCATTTGTTCTGGTGATCTGTCTCATGTCATCTTGCTCGATTA
TCCTGGGGCCCTTCTCTTTCCCATGATGCCCCTGATTTCCTCACTGCTGTTTTCATTTCTGTCTGCCATG
CTTGTCTTTATGTCGTGTGTTTCTCGTCCCTGAGTTCAACCTATGCACCCTTTCCTAACAACATGACTAC
CTCATGTCTGCTTCAGACCATAGTGTGACCCCTGGGTCCCCACAGCTCCCCTGCCAACCGCCTTCCTGGG
CAGATGAGCCCACTCCAAGTAGATCTGGAAAAGACCCTTGTGGCTTGTCTGGCTGCCCTCCCCTTGGTGT
TGAGATGAGAAGGTTTTCTATGGAAGAGATGAGTCCAGGCTGCACAGGGGAACCCCCAAGAAGGGGTAGG
GAGTGAAACCAAGAGGCTGAAAAAAAATGGCTGCCACCCATCTGCACAGAGAGATGGGTGTGTGCTTTTG
ACGTGCAGTCCTGGCTGAAACTGAAGGGGTGAGGAGAGGGGAGCTACTGGGGCTGCCATGGCTCAGTTCC
CTGACCCTGGAGCCCTGAACCTGGCTTCAGAGTAGCAAAGAGTTTCCTCCAAGATGCTGTAAGGGAAGTC
TTTGCATAGGAAAAGGGCGGCTGGCTCATTTTATTTTATCTTTCTTTACACTGAATCCCAAAATCATCTT
ACCACAAAGGGCCAAGCCTGACTGGTATTTCCTGAGTCACAAGAGCCATGCCATCTCTCTGGTTTCTCAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74962. Forward Primer - name:074962_F_cDNA_Nope, sequence:CCTCTCCTTTGAGCATCTCTGT; Reverse Primer - name:074962_N_SP6_cDNA_Nope, sequence:GTGAGAAACCAGAGAGATGGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8304 same embryo
 EMAGE:8306 same embryo
 EMAGE:8303 same embryo
 EMAGE:8305 same embryo
 EMAGE:8301 same embryo
 EurExpress:euxassay_007736 same experiment
 MGI:4825533 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS