Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8326

Ntn1 netrin 1 ( MGI:105088)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8326 EMAGE:8326 EMAGE:8326 EMAGE:8326 EMAGE:8326
"Pseudo-wholemount" of euxassay_007630. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007630_01 euxassay_007630_02 euxassay_007630_03 euxassay_007630_04
EMAGE:8326 EMAGE:8326 EMAGE:8326 EMAGE:8326 EMAGE:8326
euxassay_007630_05 euxassay_007630_06 euxassay_007630_07 euxassay_007630_08 euxassay_007630_09
EMAGE:8326 EMAGE:8326 EMAGE:8326 EMAGE:8326 EMAGE:8326
euxassay_007630_10 euxassay_007630_11 euxassay_007630_12 euxassay_007630_13 euxassay_007630_14
EMAGE:8326 EMAGE:8326 EMAGE:8326 EMAGE:8326 EMAGE:8326
euxassay_007630_15 euxassay_007630_16 euxassay_007630_17 euxassay_007630_18 euxassay_007630_19
EMAGE:8326 EMAGE:8326 EMAGE:8326 EMAGE:8326
euxassay_007630_20 euxassay_007630_21 euxassay_007630_22 euxassay_007630_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8326Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8326_wholemount_strong.wlz
8326_wholemount_moderate.wlz
8326_wholemount_weak.wlz
8326_wholemount_possible.wlz
8326_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8326_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
anterior abdominal wall muscle
moderate moderate
regionalmoderate expression: see section 21 22 23 weak expression: see section 01 02 03 05 06 18 19 20
axial muscle
moderate moderate
regionalmoderate expression: see section 21 22 23 weak expression: see section 02 03
vibrissa
weak weak
regionalweak expression: see section 02 03 04 18 19
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 moderate expression: see section 11 15 weak expression: see section 10
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 moderate expression: see section 11 15 weak expression: see section 10
telencephalon mantle layer
strong strong
regionalstrong expression: see section 16 moderate expression: see section 04 06 07 09 10 11 17 18 19 20 weak expression: see section 21
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 15 16 moderate expression: see section 07 08 09 10 11 17 18 19 20 weak expression: see section 05 06 21
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19
pons ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
strong strong
single cellstrong expression: see section 08 09 10 13 14 15 16 17 18 19
midbrain ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19
dorsal grey horn
strong strong
single cellstrong expression: see section 10 11 12 13 14 15 moderate expression: see section 16 17
ventral grey horn
strong strong
single cellstrong expression: see section 11 12 13 14 15 moderate expression: see section 16
spinal cord ventricular layer
strong strong
single cellstrong expression: see section 12 13 14
saccule
strong strong
regionalstrong expression: see section 21 moderate expression: see section 19 20 23 weak expression: see section 03 04 05 07 08 17 18
extrinsic ocular muscle
moderate moderate
regionalmoderate expression: see section 02 03 20 21 22 23 weak expression: see section 04
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 weak expression: see section 06 16
heart ventricle
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14
esophagus
moderate moderate
regionalmoderate expression: see section 12 13
tongue
strong strong
regionalstrong expression: see section 11 12 13 moderate expression: see section 14
stomach
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 weak expression: see section 09
hindgut
moderate moderate
regionalmoderate expression: see section 13 14 15
midgut
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 weak expression: see section 04 05 17 18
renal cortex
strong strong
regionalstrong expression: see section 07 08 09 10 15 16 17 18 19
lung
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18 19 20 21 22 weak expression: see section 03 04 05 06 07 08 09 10 11
axial skeleton
strong strong
regionalstrong expression: see section 12 13 14
axial skeleton tail region
strong strong
regionalstrong expression: see section 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36707
Entity Detected:Ntn1, netrin 1 ( MGI:105088)
Sequence:sense strand is shown

>T36707
CTTCCTCACCGACCTCAATAACCCGCACAACCTGACGTGCTGGCAGTCCGAGAACTACCTGCAGTTCCCG
CACAACGTGACGCTCACTCTGTCGCTCGGCAAGAAGTTTGAGGTGACCTATGTGAGCCTGCAATTCTGCT
CGCCGCGGCCAGAGTCCATGGCCATCTACAAGTCCATGGACTACGGGCGCACGTGGGTGCCCTTCCAGTT
CTATTCCACGCAGTGCCGCAAAATGTACAACCGGCCGCACCGCGCGCCTATCACCAAACAGAACGAGCAG
GAGGCCGTGTGCACCGACTCGCACACCGACATGCGCCCGCTCTCTGGCGGGCTGATCGCTTTCAGCACGC
TGGACGGGCGGCCCTCGGCGCACGACTTCGACAACTCGCCGGTGCTGCAGGACTGGGTCACGGCCACCGA
CATCCGCGTGGCTTTCAGCCGCCTGCACACGTTCGGCGACGAGAACGAAGACGACTCGGAGCTGGCGCGC
GACTCCTATTACTATGCAGTGTCTGACCTGCAGGTTGGCGGCCGCTGCAAGTGCAACGGCCACGCGGCGC
GTTGCGTGCGCGACCGAGACGACAGTCTGGTGTGTGACTGTAGGCACAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98259. Forward Primer - name:098259_F_cDNA_Ntn1, sequence:CTTCCTCACCGACCTCAATAAC; Reverse Primer - name:098259_N_SP6_cDNA_Ntn1, sequence:TTGTGCCTACAGTCACACACC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8330 same embryo
 EMAGE:8329 same embryo
 EMAGE:8325 same embryo
 EMAGE:8328 same embryo
 EMAGE:8327 same embryo
 EurExpress:euxassay_007630 same experiment
 MGI:4826817 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS