Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8333

Pak1 p21 protein (Cdc42/Rac)-activated kinase 1 ( MGI:1339975)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8333 EMAGE:8333 EMAGE:8333 EMAGE:8333 EMAGE:8333
"Pseudo-wholemount" of euxassay_007683. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007683_01 euxassay_007683_02 euxassay_007683_03 euxassay_007683_04
EMAGE:8333 EMAGE:8333 EMAGE:8333 EMAGE:8333 EMAGE:8333
euxassay_007683_05 euxassay_007683_06 euxassay_007683_07 euxassay_007683_08 euxassay_007683_09
EMAGE:8333 EMAGE:8333 EMAGE:8333 EMAGE:8333 EMAGE:8333
euxassay_007683_10 euxassay_007683_11 euxassay_007683_12 euxassay_007683_13 euxassay_007683_14
EMAGE:8333 EMAGE:8333 EMAGE:8333 EMAGE:8333 EMAGE:8333
euxassay_007683_15 euxassay_007683_16 euxassay_007683_17 euxassay_007683_18 euxassay_007683_19
EMAGE:8333 EMAGE:8333 EMAGE:8333 EMAGE:8333
euxassay_007683_20 euxassay_007683_21 euxassay_007683_22 euxassay_007683_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8333Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8333_wholemount_strong.wlz
8333_wholemount_moderate.wlz
8333_wholemount_weak.wlz
8333_wholemount_possible.wlz
8333_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8333_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
telencephalon
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
hindbrain
moderate moderate
homogeneousmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 16 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 15 16 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 08 15
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 15 16 17
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 08 15
spinal cord
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 09 10 11 14 16 17 weak expression: see section 08 15
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 21 22 23
mandible
moderate moderate
regionalmoderate expression: see section 02 03 04 14 15 17 18 19 20 weak expression: see section 05
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 09 10
lower jaw molar
strong strong
regionalstrong expression: see section 06 07 16 17
maxilla
weak weak
regionalweak expression: see section 04 05
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 09 10
upper jaw molar
strong strong
regionalstrong expression: see section 06 07 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36738
Entity Detected:Pak1, p21 protein (Cdc42/Rac)-activated kinase 1 ( MGI:1339975)
Sequence:sense strand is shown

>T36738
AGAGCAGAAGAAAAACCCACAGGCTGTTCTGGATGTGTTGGAATTTTATAACTCTAAGAAGACCTCCAAT
AGTAAGAAGTACATGAGTTTTACAGATAAGTCAGCTGAAGATTATAATTCTTCTAACACTTTGAATGTGA
AGACTGTGTCTGAGACCCCAGCAGTACCACCAGTGTCAGAAGATGATGAAGATGATGATGACGATGCTAC
CCCACCTCCAGTGATTGCTCCACGCCCAGAACACACAAAATCTGTATATACACGATCTGTGATTGAACCA
CTTCCTGTTACTCCAACTCGGGATGTGGCTACATCTCCTATTTCTCCTACTGAGAATAACACCACTCCGC
CAGATGCTTTGACCCGGAACACGGAAAAACAGAAGAAGAAGCCTAAAATGTCTGATGAGGAGATCTTAGA
GAAATTACGGAGCATAGTGAGTGTGGGTGACCCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 99294. Forward Primer - name:099294_F_cDNA_Pak1, sequence:AGAGCAGAAGAAAAACCCACAG; Reverse Primer - name:099294_N_SP6_cDNA_Pak1, sequence:GGGGTCACCCACACTCACTAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8331 same embryo
 EMAGE:8334 same embryo
 EMAGE:8332 same embryo
 EurExpress:euxassay_007683 same experiment
 MGI:4827030 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS