Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8337

P4ha3 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III ( MGI:2444049)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8337 EMAGE:8337 EMAGE:8337 EMAGE:8337 EMAGE:8337
"Pseudo-wholemount" of euxassay_007679. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007679_01 euxassay_007679_02 euxassay_007679_03 euxassay_007679_04
EMAGE:8337 EMAGE:8337 EMAGE:8337 EMAGE:8337 EMAGE:8337
euxassay_007679_05 euxassay_007679_06 euxassay_007679_07 euxassay_007679_08 euxassay_007679_09
EMAGE:8337 EMAGE:8337 EMAGE:8337 EMAGE:8337 EMAGE:8337
euxassay_007679_10 euxassay_007679_11 euxassay_007679_12 euxassay_007679_13 euxassay_007679_14
EMAGE:8337 EMAGE:8337 EMAGE:8337 EMAGE:8337 EMAGE:8337
euxassay_007679_15 euxassay_007679_16 euxassay_007679_17 euxassay_007679_18 euxassay_007679_19
EMAGE:8337 EMAGE:8337 EMAGE:8337 EMAGE:8337 EMAGE:8337
euxassay_007679_20 euxassay_007679_21 euxassay_007679_22 euxassay_007679_23 euxassay_007679_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8337Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8337_wholemount_strong.wlz
8337_wholemount_moderate.wlz
8337_wholemount_weak.wlz
8337_wholemount_possible.wlz
8337_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8337_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 14 15 weak expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 16 17 18 19 20 21 22 23 24
humerus
moderate moderate
regionalmoderate expression: see section 01 02 03 04 20 21 22 23 24
hindlimb digit 1 metatarsal
weak weak
regionalweak expression: see section 03 04 23 24
hindlimb digit 2 metatarsal
weak weak
regionalweak expression: see section 03 04 23
hindlimb digit 2 phalanx
weak weak
regionalweak expression: see section 03 24
hindlimb digit 3 metatarsal
weak weak
regionalweak expression: see section 03 04 23 24
hindlimb digit 3 phalanx
weak weak
regionalweak expression: see section 03
hindlimb digit 4 metatarsal
weak weak
regionalweak expression: see section 23 24
foot mesenchyme
weak weak
regionalweak expression: see section 05 06 24
fibula
weak weak
regionalweak expression: see section 02 03 04
tibia
weak weak
regionalweak expression: see section 02 03 04
femur
weak weak
regionalweak expression: see section 07 08 09 22 23 24
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 11 13 14
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 14
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 13 14
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 09 10 14
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 19 20 weak expression: see section 03 04 21 22 23 24
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 13 moderate expression: see section 11 weak expression: see section 14
pons ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 moderate expression: see section 05 06 07 08 09 10 11 15 16 17 18 19 20
midbrain ventricular layer
strong strong
regionalstrong expression: see section 12 14 15 moderate expression: see section 09 10 11 16 17 18
spinal cord floor plate
strong strong
regionalstrong expression: see section 12 13 14 15 16 17
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 moderate expression: see section 11
otic capsule
strong strong
regionalstrong expression: see section 07 08 09 16 17 18 19
nasal septum
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
aorta
weak weak
regionalweak expression: see section 09 10 11 12 13
mandible
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 10 11 12 13 14 15 17 18 19 20 21 weak expression: see section 07 08 09 16 22
maxilla
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 10 11 12 13 14 15 18 19 20 21 weak expression: see section 07 08 09 16 22
cricoid cartilage
weak weak
regionalweak expression: see section 11 13
thyroid cartilage
moderate moderate
regionalmoderate expression: see section 10 14 weak expression: see section 11 12 13
lung
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 21 22 23
basisphenoid bone
strong strong
regionalstrong expression: see section 01 03 04 22 24
temporal bone
strong strong
regionalstrong expression: see section 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 17 18 19 20 21 22 23 24
viscerocranium
strong strong
regionalExpression in the turbinate bone.
clavicle
weak weak
regionalweak expression: see section 07 08 09 15 16 17 18
scapula
moderate moderate
regionalmoderate expression: see section 01 03 24 weak expression: see section 02 22 23
pelvic girdle skeleton
weak weak
regionalweak expression: see section 10 11 12 19 20 21
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18 19 weak expression: see section 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36731
Entity Detected:P4ha3, procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III ( MGI:2444049)
Sequence:sense strand is shown

>T36731
AGCTCTGAAGGATGGCTATGAGAAGGTAGAGCAAGACCTTCCTGCCTTTGAGGACCTCGAGGGAGCAGCA
AGGGCCCTGATGCGGCTGCAGGATGTGTACATGCTCAACGTGAAGGGCTTGGCTCGAGGCGTCTTCCAGA
GGGTCACGGGCTCCTCCATCACCGACCTGTACAGTCCCAGGCAGCTCTTCTCTCTCACAGCGGATGACTG
CTTCCAAGTTGGCAAGGTGGCCTATGACACAGGGGATTACTACCATGCCATCCCATGGCTGGAGGAAGCT
GTCAGTCTCTTCCGGAGAGCCCACGGCGAGTGGAAGACAGAGGACGAGGCCAGTCTGGAAGACGCCCTGG
ATTACTTGGCCTTTGCCTGTTTCCAGGTAGGAAATGTTTCATGTGCCCTCAGCCTCTCTCGAGAGTTCCT
TGTCTACAGCCCAGACAATAAGAGGATGGCCAGGAATGTGTTGAAATATGAAAGGCTCTTGGCTGAGAAT
GGTCACCAGATGGCGGCTGAGACTGCAATTCAGAGGCCCAACGTACCCCACCTGCAGACCAGGGACACCT
ACGAGGGGCTATGCCAGACCCTGGGCTCCCAGCCAACACACTACCAAATCCCCAGCCTCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 72497. Forward Primer - name:072497_F_cDNA_P4ha3, sequence:AGCTCTGAAGGATGGCTATGAG; Reverse Primer - name:072497_N_SP6_cDNA_P4ha3, sequence:AGAGGCTGGGGATTTGGTAGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8338 same embryo
 EMAGE:8335 same embryo
 EMAGE:8336 same embryo
 EurExpress:euxassay_007679 same experiment
 MGI:4827018 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS