Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8374

Tnc tenascin C ( MGI:101922)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8374 EMAGE:8374 EMAGE:8374 EMAGE:8374 EMAGE:8374
"Pseudo-wholemount" of euxassay_009501. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009501_01 euxassay_009501_02 euxassay_009501_03 euxassay_009501_04
EMAGE:8374 EMAGE:8374 EMAGE:8374 EMAGE:8374 EMAGE:8374
euxassay_009501_05 euxassay_009501_06 euxassay_009501_07 euxassay_009501_08 euxassay_009501_09
EMAGE:8374 EMAGE:8374 EMAGE:8374 EMAGE:8374 EMAGE:8374
euxassay_009501_10 euxassay_009501_11 euxassay_009501_12 euxassay_009501_13 euxassay_009501_14
EMAGE:8374 EMAGE:8374 EMAGE:8374 EMAGE:8374 EMAGE:8374
euxassay_009501_15 euxassay_009501_16 euxassay_009501_17 euxassay_009501_18 euxassay_009501_19
EMAGE:8374 EMAGE:8374 EMAGE:8374 EMAGE:8374
euxassay_009501_20 euxassay_009501_21 euxassay_009501_22 euxassay_009501_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8374Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8374_wholemount_strong.wlz
8374_wholemount_moderate.wlz
8374_wholemount_weak.wlz
8374_wholemount_possible.wlz
8374_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8374_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 14 15 16 17 18 19 20 21 22 23
diaphragm
strong strong
regionalstrong expression: see section 18 19 20 21 22 23 moderate expression: see section 01 02 03 04 05 06 07 10 11 12 13 14 15 16 17
humerus
strong strong
regionalstrong expression: see section 01 02 03 04 20 21 22 23
hand
strong strong
regionalstrong expression: see section 01 20 21 22 23 moderate expression: see section 02
hindlimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 06 07 08 21 22
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 19 20 21 22 23
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 19 20 21 22 23
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 19 20 21 22
hindlimb digit 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 08 09 20 21
fibula
moderate moderate
regionalmoderate expression: see section 01 02 03 22 23
tibia
moderate moderate
regionalmoderate expression: see section 01 02 03 22 23
thymus primordium
strong strong
regionalstrong expression: see section 10 13 moderate expression: see section 11 12 14
vibrissa
moderate moderate
regionalmoderate expression: see section 03 04 20 21
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14
olfactory cortex ventricular layer
strong strong
regionalstrong expression: see section 09 10 14 15 16
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 10 14 15
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 13 14 15
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21
pons mantle layer
strong strong
single cellstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain mantle layer
strong strong
single cellstrong expression: see section 07 10 11 14 15 16 17 18 19
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 20 21 22
trigeminal v nerve maxillary division
moderate moderate
single cellmoderate expression: see section 04 05 06 07 18 19 20
dorsal grey horn
strong strong
single cellstrong expression: see section 12
ventral grey horn
strong strong
single cellstrong expression: see section 10 11 12 13 14
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 07 08 09 14 15 16 17
cochlea
strong strong
regionalstrong expression: see section 16 17 moderate expression: see section 04 18 19 20
cochlear duct
strong strong
regionalstrong expression: see section 08 moderate expression: see section 05 06
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 04 05 20 21 22 23
nasal septum
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16
heart ventricle
moderate moderate
single cellmoderate expression: see section 05 06 07 08 09 11 13 14 15
esophagus
weak weak
regionalweak expression: see section 11
tongue
moderate moderate
regionalmoderate expression: see section 08
tongue muscle
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
lower lip
strong strong
regionalstrong expression: see section 04 07 08 09 10 11 12 13 14 15 16 19 20 moderate expression: see section 05 06
mandible
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 16 17 18 19 20 21 22
lower jaw molar
strong strong
regionalstrong expression: see section 06 07 16 17
upper lip
strong strong
regionalstrong expression: see section 04 07 08 09 10 11 12 13 14 15 16 20 moderate expression: see section 05 06
maxilla
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 16 17 18 19
palatal shelf
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14
upper jaw molar
strong strong
regionalstrong expression: see section 06 16 17 18
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 weak expression: see section 03
axial skeleton
strong strong
regionalstrong expression: see section 06 07 09 10 13 14 17
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 20 21 22 23
basisphenoid bone
strong strong
regionalstrong expression: see section 01 02 03 20 21 22 23
exoccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 19 20 21 22 23
temporal bone
strong strong
regionalstrong expression: see section 03 21 22 23
vault of skull
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 19 20 21 22 23
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 19 20 21 22 23
clavicle
strong strong
regionalstrong expression: see section 06 07 08 09 14 15 16
scapula
strong strong
regionalstrong expression: see section 02 03 04 21 22 23
sternum
strong strong
regionalstrong expression: see section 10 11 12 13
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 07 08 15 16
axial skeleton tail region
strong strong
regionalstrong expression: see section 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36869
Entity Detected:Tnc, tenascin C ( MGI:101922)
Sequence:sense strand is shown

>T36869
ATCTTTGCAGAGAAAGGACAGCAGAAGAGCTCTACCATCGCCACCAAGTTTACCACAGACCTCGATTCCC
CAAGAGAATTTACAGCTACAGAGGTTCAGTCAGAAACTGCCCTCCTTACCTGGAGACCTCCCCGAGCATC
GGTCACTGGATACCTCCTGGTCTATGAATCTGTGGATGGTACAGTCAAGGAAGTCATTGTGGGGCCTGAC
ACCACCTCCTACAGCCTGGCAGACCTGAGCCCATCCACCCACTACTCAGCAAGGATCCAGGCATTGAGTG
GGTCCCTGAGGAGCAAGCTGATCCAAACCATCTTCACAACAATTGGACTCCTGTACCCATTCCCCAGGGA
CTGCTCTCAAGCAATGTTGAATGGTGATACTACCTCTGGCCTCTACACCATCTATATAAATGGTGACAAG
ACTCAAGCACTGGAAGTCTACTGTGATATGACCTCTGATGGAGGTGGATGGATTGTTTTCCTGAGACGCA
AAAATGGACGTGAGGACTTCTATCGCAACTGGAAGGCCTATGCTGCTGGGTTTGGAGACCGCAGAGAAGA
ATTTTGGCTTGGACTGGATAACCTGAGCAAAATCACAGCCCAAGGGCAGTATGAGCTCCGGGTGGACCTA
CAAGACCATGGGGAGTCTGCCTATGCTGTGTACGACAGATTCAGTGTTGGAGATGCCAAGAGTCGCTACA
AGCTGAAGGTAGAAGGATACAGTGGAACAGCAGGTGACTCCATGAACTATCACAATGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 99514. Forward Primer - name:099514_F_cDNA_Tnc, sequence:ATCTTTGCAGAGAAAGGACAGC; Reverse Primer - name:099514_N_SP6_cDNA_Tnc, sequence:CCATTGTGATAGTTCATGGAGTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8370 same embryo
 EMAGE:8371 same embryo
 EMAGE:8372 same embryo
 EMAGE:8369 same embryo
 EMAGE:8373 same embryo
 EurExpress:euxassay_009501 same experiment
 MGI:4828838 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS