Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8375

Prickle1 prickle homolog 1 (Drosophila) ( MGI:1916034)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8375 EMAGE:8375 EMAGE:8375 EMAGE:8375 EMAGE:8375
"Pseudo-wholemount" of euxassay_009520. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009520_01 euxassay_009520_02 euxassay_009520_03 euxassay_009520_04
EMAGE:8375 EMAGE:8375 EMAGE:8375 EMAGE:8375 EMAGE:8375
euxassay_009520_05 euxassay_009520_06 euxassay_009520_07 euxassay_009520_08 euxassay_009520_09
EMAGE:8375 EMAGE:8375 EMAGE:8375 EMAGE:8375 EMAGE:8375
euxassay_009520_10 euxassay_009520_11 euxassay_009520_12 euxassay_009520_13 euxassay_009520_14
EMAGE:8375 EMAGE:8375 EMAGE:8375 EMAGE:8375 EMAGE:8375
euxassay_009520_15 euxassay_009520_16 euxassay_009520_17 euxassay_009520_18 euxassay_009520_19
EMAGE:8375 EMAGE:8375 EMAGE:8375 EMAGE:8375
euxassay_009520_20 euxassay_009520_21 euxassay_009520_22 euxassay_009520_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8375Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8375_wholemount_strong.wlz
8375_wholemount_moderate.wlz
8375_wholemount_weak.wlz
8375_wholemount_possible.wlz
8375_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8375_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 03 20
forelimb digit 3 phalanx
strong strong
regionalstrong expression: see section 03 04 05 18 19 20 23 moderate expression: see section 21 22
forelimb digit 4 phalanx
strong strong
regionalstrong expression: see section 03 04 18 19 20 23 moderate expression: see section 22
hindlimb digit 1 metatarsal
moderate moderate
regionalmoderate expression: see section 02
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 03 04 18 19 20 moderate expression: see section 01 17 21
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 03 04 18 19 20 moderate expression: see section 01 02 17 21
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 03 04 16 18 19 20 moderate expression: see section 01 02 17 21
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 03 04 16 18 19 20 moderate expression: see section 01 02 17 21
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 03 04 18 19 20 moderate expression: see section 01 02 17 21
pituitary gland
strong strong
regionalstrong expression: see section 10 11 12 13 14 15
cerebral cortex marginal layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 12 moderate expression: see section 09 13 15 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 15 16 17 18
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 13
basal columns
weak weak
regionalweak expression: see section 11 12
otic capsule
moderate moderate
regionalmoderate expression: see section 06 07 08 09 weak expression: see section 16 17
naris
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
viscerocranium
strong strong
regionalExpression in the turbinate bone.
heart valve
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
tongue epithelium
strong strong
regionalstrong expression: see section 09 10 12 13 14 15 moderate expression: see section 08 11
lower jaw incisor
strong strong
regionalstrong expression: see section 11 moderate expression: see section 10
urinary system
strong strong
regionalstrong expression: see section 04 05 23
male reproductive system
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 16 17 18 19 20 21 22
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 11 13
urethra of male
moderate moderate
regionalmoderate expression: see section 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36893
Entity Detected:Prickle1, prickle homolog 1 (Drosophila) ( MGI:1916034)
Sequence:sense strand is shown

>T36893
TGGGAACTCTGAACTCTTCCATGCTGCACAGGAGTGCAGAATCCTTACAAAGTCTGAACTCAGGGCTGTG
CCCAGAAAAAATTCTACCTGAGGAAAAACCAGCACACCTGCCGGTGCTCAGGAGATCCAAGTCCCAGTCC
CGACCACAGCAGGTCAAATTTTCAGATGACGTCATTGACAACGGAAGCTACGACATCGAAATCCGGCAGC
CTCCCATGAGCGAACGGACTCGGAGACGGGCGTATCACTTTGAAGAGAGGGGATCCAGGCCTCACCACCA
TCGCCACCGGAGAAGCAGAAAGTCTCGGTCCGACAACGCCCTGAACCTGGTCACGGAAAGGAAGTACTCC
GCCAAGGACAGACTTCGGCTGTACACCCCCGATAACTATGAGAAATTCATACAGAATAAAAGCGCCCGGG
AGCTCCAAGCCTACATGCAGAACGCCAACCTCTATAGCCAGTATGCCCATGCCACGTCTGATTACGCCCT
GCAGAACCCAGGGATGAACCGGTTTCTGGGGCTCTGCGGCGAGGACGACGACTCGTGGTGTTCGTCCTCC
ACGTCCTCCTCCGACTCAGAAGAAGAAGGCTATTTCCTTGGCCAGCCGATCCCTCAGCCACGGCCACAGA
GATTCACCTACTATACAGATGACCTTTCTAGCCCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 88056. Forward Primer - name:088056_F_cDNA_Prickle1, sequence:TGGGAACTCTGAACTCTTCCAT; Reverse Primer - name:088056_N_SP6_cDNA_Prickle1, sequence:CGGGCTAGAAAGGTCATCTGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8380 same embryo
 EMAGE:8379 same embryo
 EMAGE:8378 same embryo
 EMAGE:8376 same embryo
 EMAGE:8377 same embryo
 EurExpress:euxassay_009520 same experiment
 MGI:4827411 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS