Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8427

Atp6v0c ATPase, H+ transporting, lysosomal V0 subunit C ( MGI:88116)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8427 EMAGE:8427 EMAGE:8427 EMAGE:8427 EMAGE:8427
"Pseudo-wholemount" of euxassay_009616. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009616_01 euxassay_009616_02 euxassay_009616_03 euxassay_009616_04
EMAGE:8427 EMAGE:8427 EMAGE:8427 EMAGE:8427 EMAGE:8427
euxassay_009616_05 euxassay_009616_06 euxassay_009616_07 euxassay_009616_08 euxassay_009616_09
EMAGE:8427 EMAGE:8427 EMAGE:8427 EMAGE:8427 EMAGE:8427
euxassay_009616_10 euxassay_009616_11 euxassay_009616_12 euxassay_009616_13 euxassay_009616_14
EMAGE:8427 EMAGE:8427 EMAGE:8427 EMAGE:8427 EMAGE:8427
euxassay_009616_15 euxassay_009616_16 euxassay_009616_17 euxassay_009616_18 euxassay_009616_19
EMAGE:8427 EMAGE:8427 EMAGE:8427 EMAGE:8427 EMAGE:8427
euxassay_009616_20 euxassay_009616_21 euxassay_009616_22 euxassay_009616_23 euxassay_009616_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8427Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8427_wholemount_strong.wlz
8427_wholemount_moderate.wlz
8427_wholemount_weak.wlz
8427_wholemount_possible.wlz
8427_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8427_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
forebrain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
hindbrain
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 18 19 20 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 18 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 16 17 18 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 08 17
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 08 17 moderate expression: see section 06 07 18 19
trigeminal v nerve
strong strong
regionalstrong expression: see section 08 09 16
spinal cord
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 10 16
cervical ganglion
moderate moderate
regionalmoderate expression: see section 09 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 11
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 12 13 14 15 16 17 18
neural retina
strong strong
regionalstrong expression: see section 22 23 24 moderate expression: see section 02
mandible
moderate moderate
regionalmoderate expression: see section 02 03 04 05 weak expression: see section 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22
maxilla
moderate moderate
regionalmoderate expression: see section 04 05 weak expression: see section 06 07 08 09 10 14 15 16 17 18 19 20
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 02 03 04 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35961
Entity Detected:Atp6v0c, ATPase, H+ transporting, lysosomal V0 subunit C ( MGI:88116)
Sequence:sense strand is shown

>T35961
GAGTTTTCTTCAACTGGGTGCTGGCCTGAGTGTGGGGCTGAGTGGCCTGGCTGCTGGCTTTGCCATTGGC
ATCGTCGGAGATGCTGGTGTTCGGGGCACTGCCCAGCAGCCTCGACTGTTCGTGGGCATGATCCTGATCC
TCATCTTTGCGGAGGTGCTTGGCCTCTACGGTCTCATCGTGGCCCTAATCCTCTCCACAAAGTAGTCCTT
TTCCACCATCAGTCACAGGATAGGATGTAAAGATCACCCCTCCTCATTCCAGAACGAACAGCCTGACACA
TGCACGGGCAGCTGCCCCTCAGTAGTTGGTCTTGTAAATGTGCAGTGTCCTAGTGCCCATTGTCTGTCGC
CCCCGCCTTGCCCCTACTGCACCGTGCTGTGGACATACGGGCCCACTCATCTCCCACCCAGGCCCCTGAC
CAGTGACGAAGTCAGCCTCTGGTTACCCCACCCATCGCCCTAGAGTGCTCCTGTGTATAAGAATGAACTA
GAGTTGTCATTTTTCTCTTCACTGGATGTTTATTTATAAAAGATTTGACCTATTCATGCGTCTGTGGAGC
AGCTCCTGTCTCCCAACTATATAGTAATCATTAGTAGACTGTTGCCTTGTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 89761. Forward Primer - name:089761_F_cDNA_Atp6v0c, sequence:GAGTTTTCTTCAACTGGGTGCT; Reverse Primer - name:089761_N_SP6_cDNA_Atp6v0c, sequence:CCACAAGGCAACAGTCTACTAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8426 same embryo
 EMAGE:8425 same embryo
 EMAGE:8423 same embryo
 EMAGE:8424 same embryo
 EurExpress:euxassay_009616 same experiment
 MGI:4823321 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS