Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8439

Robo1 roundabout homolog 1 (Drosophila) ( MGI:1274781)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8439 EMAGE:8439 EMAGE:8439 EMAGE:8439 EMAGE:8439
"Pseudo-wholemount" of euxassay_009691. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009691_01 euxassay_009691_02 euxassay_009691_03 euxassay_009691_04
EMAGE:8439 EMAGE:8439 EMAGE:8439 EMAGE:8439 EMAGE:8439
euxassay_009691_05 euxassay_009691_06 euxassay_009691_07 euxassay_009691_08 euxassay_009691_09
EMAGE:8439 EMAGE:8439 EMAGE:8439 EMAGE:8439 EMAGE:8439
euxassay_009691_10 euxassay_009691_11 euxassay_009691_12 euxassay_009691_13 euxassay_009691_14
EMAGE:8439 EMAGE:8439 EMAGE:8439 EMAGE:8439 EMAGE:8439
euxassay_009691_15 euxassay_009691_16 euxassay_009691_17 euxassay_009691_18 euxassay_009691_19
EMAGE:8439 EMAGE:8439 EMAGE:8439 EMAGE:8439 EMAGE:8439
euxassay_009691_20 euxassay_009691_21 euxassay_009691_22 euxassay_009691_23 euxassay_009691_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8439Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8439_wholemount_strong.wlz
8439_wholemount_moderate.wlz
8439_wholemount_weak.wlz
8439_wholemount_possible.wlz
8439_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8439_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1 metatarsal
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 24
hindlimb digit 1 phalanx
weak weak
regionalweak expression: see section 24
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 07 08 09 weak expression: see section 24
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 07 08 weak expression: see section 24
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 07 08 weak expression: see section 24
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 08 09 weak expression: see section 24
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 08 09 weak expression: see section 24
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 24
hindlimb digit 5 metatarsal
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 24
hindlimb digit 5 phalanx
weak weak
regionalweak expression: see section 24
tarsus
moderate moderate
regionalmoderate expression: see section 07 09 weak expression: see section 10 23 24
adrenal gland
weak weak
regionalweak expression: see section 09 10 17 18
vibrissa
weak weak
regionalweak expression: see section 04 05 06 07 19 20 21
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 10 12 13 14 15 16 17 18 19 20
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 16 17 18 19 20 21 22 23 24 weak expression: see section 03
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 12 16 17 18
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19 20
rest of cerebellum mantle layer
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 19 20 21 22 23
pons mantle layer
moderate moderate
homogeneousmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain mantle layer
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19 20 21
ventral grey horn
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18
extrinsic ocular muscle
moderate moderate
regionalmoderate expression: see section 06 07 21 22 23 weak expression: see section 04 05
nasal septum
weak weak
regionalweak expression: see section 12 13 15 16
viscerocranium
weak weak
regionalExpression in the turbinate bone.
midgut
weak weak
regionalweak expression: see section 10 11 12 13 14 17
lower lip
weak weak
regionalweak expression: see section 07 08 09 18 19 20
mandible
moderate moderate
regionalmoderate expression: see section 04 05 23 24 weak expression: see section 06 22
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 15 16
lower jaw molar
weak weak
regionalweak expression: see section 08 09
palatal shelf
weak weak
regionalweak expression: see section 12 13 15 16 17
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 15 16
upper jaw molar
weak weak
regionalweak expression: see section 08 20
metanephros
weak weak
regionalweak expression: see section 08 09 10 11 17 18 19 20 21
genital tubercle of male
weak weak
regionalweak expression: see section 14 15 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36971
Entity Detected:Robo1, roundabout homolog 1 (Drosophila) ( MGI:1274781)
Sequence:sense strand is shown

>T36971
CTGAAGACAACCAGAGAGGCTTACGATGCTAATGTGAAAAACCATCACTCAAGAGGCCTCCTCCCGTCTG
ATGACACACAATACCAGATGAAATTGTTCAGTGCAATCAGAATGGACAAGTTGCCGTTTTTATTCCTCCT
GTTGGGATAACATTTTTTAAAAGTTTCTTGGGTTTTTAGTGTTGCTGATTGATTGCCTAACCCTTAATGA
ACCTCCCCCTGCCGCGACGCTGTTACAGCCGTTATCCTTGACTTCCAACACTGGAAGTGTCTTGAATGCT
TGCTTCAGCCATCAGCCAGCAAGGAAGAACAGACCAATTCTTTTTGCGATTTGCCCCTGAGATATGGCAT
TGCACTGCTTATATATCACGCTAATTGATAGCAAAATATTGATCAATGATATAAAGGTGATGACTCAACC
TCATGCCAAGGGCTCTCAAAGTATAATTGTTCTATGACCAACTGCTAAGGCCAATTGAAGCATACTTCAT
TTTACATGATTTTAGGATCAGTCTTTTATACCACCCTTTGCTGGCATAAACTAAAAGTCTATCACATACA
GAACTACAGTCTAATTTCAATGGGGTAGAAGCATTGTAAATATATACTCTTTGCAACTCCTGGTGGTACT
TTATTTTGTCTTTATTTCAACCATTGAAATATATTCTTGAAATGTACTTTTGGATAAGTAGGGCTGAGCC
AGTTGGACCTCTGGTTGTCTTAGTCATTGTGAGAAGTAAACCTAGCAAAAATCTTGTTCTATTTTTCAAT
CAAAAAGCAACTACAAATGCATATTCCACGCAAATGGATGTTTTTAACGACCAATTGAGTAAAGACATCC
CTATCTTAACTGGCCTAAATTTCTTCTGGTAGTGTCAGATCACCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 100214. Forward Primer - name:100214_F_cDNA_Robo1, sequence:CTGAAGACAACCAGAGAGGCTT; Reverse Primer - name:100214_N_SP6_cDNA_Robo1, sequence:AGGTGATCTGACACTACCAGAAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8443 same embryo
 EMAGE:8438 same embryo
 EMAGE:8442 same embryo
 EMAGE:8440 same embryo
 EMAGE:8441 same embryo
 EurExpress:euxassay_009691 same experiment
 MGI:4827785 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS