Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8488

Neo1 neogenin ( MGI:1097159)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8488 EMAGE:8488 EMAGE:8488 EMAGE:8488 EMAGE:8488
"Pseudo-wholemount" of euxassay_009739. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009739_01 euxassay_009739_02 euxassay_009739_03 euxassay_009739_04
EMAGE:8488 EMAGE:8488 EMAGE:8488 EMAGE:8488 EMAGE:8488
euxassay_009739_05 euxassay_009739_06 euxassay_009739_07 euxassay_009739_08 euxassay_009739_09
EMAGE:8488 EMAGE:8488 EMAGE:8488 EMAGE:8488 EMAGE:8488
euxassay_009739_10 euxassay_009739_11 euxassay_009739_12 euxassay_009739_13 euxassay_009739_14
EMAGE:8488 EMAGE:8488 EMAGE:8488 EMAGE:8488 EMAGE:8488
euxassay_009739_15 euxassay_009739_16 euxassay_009739_17 euxassay_009739_18 euxassay_009739_19
EMAGE:8488 EMAGE:8488 EMAGE:8488 EMAGE:8488 EMAGE:8488
euxassay_009739_20 euxassay_009739_21 euxassay_009739_22 euxassay_009739_23 euxassay_009739_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8488Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8488_wholemount_strong.wlz
8488_wholemount_moderate.wlz
8488_wholemount_weak.wlz
8488_wholemount_possible.wlz
8488_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8488_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diaphragm
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17
pericardial cavity
moderate moderate
regionalmoderate expression: see section 05 06 07 weak expression: see section 08 09 10 17 18 19 20 21 22
interdigital region between hindlimb digits 1 and 2
weak weak
regionalweak expression: see section 05 06 07 22 23
interdigital region between hindlimb digits 2 and 3
weak weak
regionalweak expression: see section 05 06 22 23
interdigital region between hindlimb digits 3 and 4
weak weak
regionalweak expression: see section 05 22 23
interdigital region between hindlimb digits 4 and 5
weak weak
regionalweak expression: see section 06 07 22 23
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 07 21 22
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 12 13 14 15
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 17 18 19 20 21 22 23 24 moderate expression: see section 12 13 14 15 16
telencephalon mantle layer
strong strong
regionalstrong expression: see section 03 04 05 moderate expression: see section 06
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 10 16 moderate expression: see section 17 18
rest of cerebellum marginal layer
weak weak
regionalweak expression: see section 05 06 07 08 09 18
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 19 20 21 weak expression: see section 04 05 06 07 08 09 18
midbrain mantle layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 16 17 18
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 08 09 17 18 19
ventral grey horn
moderate moderate
regionalmoderate expression: see section 11 12 14 15 weak expression: see section 10
nasal septum
weak weak
regionalweak expression: see section 12 13 15 16
viscerocranium
weak weak
regionalExpression in the turbinate bone.
mandible
moderate moderate
regionalmoderate expression: see section 19 20 21 weak expression: see section 05 06 07 08 09 10 11 15 18
maxilla
moderate moderate
regionalmoderate expression: see section 19 20 21 weak expression: see section 06 07 08 09 10 18
lung
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 22
axial skeleton
weak weak
regionalweak expression: see section 08 09 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30577
Entity Detected:Neo1, neogenin ( MGI:1097159)
Sequence:sense strand is shown

>T30577
AGGGCTTCCTGCTCCAGTTGTTAGATGGATGAAAAACGAAGAAGTGCTTGACACAGAAAGCTCTGGCAGG
TTGGTCTTGCTAGCAGGAGGTTGCTTGGAGATCAGTGATGTCACTGAGGATGATGCTGGGACTTATTTTT
GCATAGCTGATAATGGAAATAAGACAGTTGAAGCTCAGGCGGAGCTTACTGTGCAAGTGCCACCTGGATT
CCTGAAACAACCTGCTAACATATATGCTCACGAATCCATGGACATTGTATTTGAATGTGAAGTCACTGGG
AAGCCAACTCCAACTGTGAAGTGGGTCAAGAATGGGGATGTGGTTATCCCCAGTGATTACTTTAAAATTG
TAAAGGAACATAATCTTCAAGTTTTGGGTCTGGTGAAATCAGATGAAGGGTTCTATCAATGCATTGCTGA
GAATGATGTTGGAAATGCACAAGCTGGAGCCCAGCTGATAATCCTTGAGCATGATGTTGCCATCCCAACA
TTACCTCCCACTTCACTGACCAGTGCCACTACTGACCATCTAGCACCAGCCACAACGGGACCATTACCTT
CAGCTCCTCGAGACGTCGTGGCCTCCCTGGTCTCTACTCGCTTCATTAAATTGACATGGCGTACACCTGC
ATCAGACCCTCATGGAGACAATCTCACCTACTCTGTGTTCTACACCAAGGAAGGGGTTGCTAGGGAGCGT
GTTGAGAATACCAGCCAGCCAGGAGAGATGCAGGTGACTATTCAAAACTTGATGCCAGCAACTGTGTACA
TCTTCAAAGTTATGGCTCAAAATAAGCATGGCTCTGGAGAAAGTTCAGCTCCTCTTCGAGTAGAGACACA
GCCTGAGGTTCAGCTCCCTGGCCCAGCACCTAATATCCGTGCTTATGCAACGTCACCTACTTCTATCACT
GTCACCTGGGAAACACCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6406007), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59053. Forward Primer - name:059053_F_IRAV113_b08_Neo1, sequence:AGGGCTTCCTGCTCCAGT; Reverse Primer - name:059053_R_SP6_IRAV113_b08_Neo1, sequence:ACGGTGTTTCCCAGGTGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8489 same embryo
 EMAGE:8487 same embryo
 EMAGE:8486 same embryo
 EMAGE:8490 same embryo
 EMAGE:8485 same embryo
 EurExpress:euxassay_009739 same experiment
 MGI:4826666 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS