Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8502

Ankrd46 ankyrin repeat domain 46 ( MGI:1916089)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8502 EMAGE:8502 EMAGE:8502 EMAGE:8502 EMAGE:8502
"Pseudo-wholemount" of euxassay_007253. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007253_01 euxassay_007253_02 euxassay_007253_03 euxassay_007253_04
EMAGE:8502 EMAGE:8502 EMAGE:8502 EMAGE:8502 EMAGE:8502
euxassay_007253_05 euxassay_007253_06 euxassay_007253_07 euxassay_007253_08 euxassay_007253_09
EMAGE:8502 EMAGE:8502 EMAGE:8502 EMAGE:8502 EMAGE:8502
euxassay_007253_10 euxassay_007253_11 euxassay_007253_12 euxassay_007253_13 euxassay_007253_14
EMAGE:8502 EMAGE:8502 EMAGE:8502 EMAGE:8502 EMAGE:8502
euxassay_007253_15 euxassay_007253_16 euxassay_007253_17 euxassay_007253_18 euxassay_007253_19
EMAGE:8502
euxassay_007253_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8502Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8502_wholemount_strong.wlz
8502_wholemount_moderate.wlz
8502_wholemount_weak.wlz
8502_wholemount_possible.wlz
8502_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8502_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 13 14
pons mantle layer
weak weak
regionalweak expression: see section 07 15
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 15 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 15 16 17 18 weak expression: see section 19 20
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 10 12 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1842
Entity Detected:Ankrd46, ankyrin repeat domain 46 ( MGI:1916089)
Sequence:sense strand is shown

>T1842
GCGGCCAGGGGCCTGTCAGTGTGGCTTTTCAGTTCTTANACTATTCCTTAGGCAAGGCAGCGAGGCCTGT
CTGTGTTTAGGATTTGTATTTACCGTGATCCTTACGGAGGAATGACGTGTCCCACTGAACTTCGTCCTGC
CGCTGGTTAGACTCATTCTCATGCTACCCTCTGATGCCGCCTGTGTCTGAGGAAGGCATCCCCAGGCTTG
TGTGACCCAAGTGTGGTGATAACCAGGTGGACACTCAAGGCAGAGGCTTGGGAGGCCTCACAGTGGGGCC
CGACCTTGATGGAGGAGCAGTGACAGAAAGCGGATTTCTTTTTCTAGGATTCCATTTGCCAGTGGCTTTG
TTTTCCCTCGTTTGTTCCTTTTGCAATAGNATTCTGTTTTTATTTACTTTCCTGGCAAGAGGAGGGAGTG
AAAACTTTCAACTTGAATTTTAATTACTTTTACAATCTATATGACAAATTAGAACTGTTANGAATTTTGA
CTTTAAAAGTATGTAGTCAGATAGNAGACAGG
Notes:The probe template was PCR amplified from IMAGE:582082 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:582082 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8506 same embryo
 EMAGE:8505 same embryo
 EMAGE:8504 same embryo
 EMAGE:8507 same embryo
 EMAGE:8503 same embryo
 EurExpress:euxassay_007253 same experiment
 MGI:4823137 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS